ID: 1187489014

View in Genome Browser
Species Human (GRCh38)
Location X:19732463-19732485
Sequence ATAGATAATACAGCATTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 4, 3: 52, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187489014_1187489017 12 Left 1187489014 X:19732463-19732485 CCCACAAATGCTGTATTATCTAT 0: 1
1: 1
2: 4
3: 52
4: 307
Right 1187489017 X:19732498-19732520 GAAAAAAATCTACATATAAGTGG 0: 4
1: 77
2: 251
3: 580
4: 1338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187489014 Original CRISPR ATAGATAATACAGCATTTGT GGG (reversed) Intronic
901524066 1:9808209-9808231 ATGGAAAATACAGTATTTGTGGG - Intronic
905074360 1:35256678-35256700 ATAAAAAATAAAGAATTTGTGGG - Intergenic
905612569 1:39367269-39367291 AGAGATAAAACTGTATTTGTAGG - Intronic
905821367 1:40994488-40994510 TTAGATAATACCCCATGTGTAGG + Intronic
906271136 1:44479757-44479779 ATAGAGAACCCAGAATTTGTGGG - Intronic
909381112 1:74999769-74999791 AGAAATAATACAGTATTTTTGGG - Intergenic
909412274 1:75368404-75368426 ATCAAAAATACAGTATTTGTGGG - Intronic
910038940 1:82823979-82824001 AGCGATTAGACAGCATTTGTGGG - Intergenic
910056561 1:83039631-83039653 ATAGATAATACAGAATTCCAGGG - Intergenic
910350813 1:86295387-86295409 ATAGAACATACAGCATCTGGTGG - Intergenic
911989823 1:104680544-104680566 AAAGATGAGACAGCATATGTTGG + Intergenic
912327251 1:108778929-108778951 ATAGAAAATACAGTATTTGCAGG - Intronic
912632552 1:111258281-111258303 ATAGATGATAAAGCCCTTGTAGG - Intergenic
913313611 1:117530388-117530410 AAGGATAATACAGGATTTCTAGG + Intergenic
913649802 1:120902002-120902024 ATTGAAAATACAGTATTTGTGGG - Intergenic
914076881 1:144361508-144361530 ATTGAAAATATAGTATTTGTGGG + Intergenic
914102297 1:144604989-144605011 ATTGAAAATATAGTATTTGTGGG - Intergenic
914171330 1:145227085-145227107 ATTGAAAATATAGTATTTGTGGG + Intergenic
914296602 1:146332209-146332231 ATTGAAAATATAGTATTTGTGGG + Intergenic
914526439 1:148471057-148471079 ATTGAAAATATAGTATTTGTGGG + Intergenic
914639964 1:149596059-149596081 ATTGAAAATATAGTATTTGTGGG - Intergenic
916388402 1:164303629-164303651 ATAGATAATACATAACTTATGGG - Intergenic
917109947 1:171537495-171537517 ATAGATGATACAGAATATTTTGG + Intronic
917213809 1:172657655-172657677 ATAAATAATACATTATTTTTAGG - Intergenic
918600676 1:186355958-186355980 AGAGATAATTCAGTATTTATGGG + Intronic
919331649 1:196180059-196180081 ATTAAAAATACAGCATTTGTGGG + Intergenic
921040725 1:211429183-211429205 ATTGACAATACAGTATTTGTGGG + Intergenic
922064335 1:222122458-222122480 ATAGATAATACTTTATTTTTAGG + Intergenic
922577136 1:226668770-226668792 ATAGACAAAGCCGCATTTGTTGG - Intronic
923084302 1:230690796-230690818 ATGTATAATACAGTTTTTGTGGG + Intronic
923402319 1:233627244-233627266 ATAAAAAATACAGTATTTGAGGG - Intronic
923565309 1:235072113-235072135 ATACATAATTCAGGATTTCTTGG - Intergenic
923570343 1:235107814-235107836 CTAGATAAAACAGCATCTCTTGG + Intergenic
924011479 1:239669915-239669937 TAAAATAATCCAGCATTTGTGGG - Intronic
924062643 1:240192012-240192034 ATAGATCATACAACATATGGGGG - Intronic
1065314058 10:24444637-24444659 ATGAATAATATGGCATTTGTAGG - Intronic
1068330142 10:55554574-55554596 ATCGAAAATACAGCTTTTGTGGG + Intronic
1068548597 10:58380849-58380871 ATAAATAAGAAAGCATTTATGGG + Intergenic
1068562364 10:58529437-58529459 ATAGATAATACAAGATTTAGTGG - Intronic
1069117040 10:64520478-64520500 ATTGAAAATACGACATTTGTGGG + Intergenic
1069253320 10:66299334-66299356 ATATTTAATCCAGCATTTTTAGG - Intronic
1070095976 10:73338757-73338779 ATCAAAAATACAGTATTTGTGGG + Intronic
1070112737 10:73500478-73500500 ATAAATATTAAATCATTTGTTGG - Intronic
1071029377 10:81157468-81157490 ATAGATAATTTAGCATATTTGGG + Intergenic
1071046417 10:81384837-81384859 AAAGAAATTACAGCATTTGCAGG + Intergenic
1072440863 10:95453747-95453769 ATCAAAAATATAGCATTTGTAGG + Intronic
1072999155 10:100273399-100273421 AAAGATAATACAGAATTTAATGG - Intronic
1075577730 10:123591219-123591241 ATAAAAAATACAGTATTTGTGGG + Intergenic
1075826550 10:125361725-125361747 ATACAGATTACAGCATCTGTTGG - Intergenic
1077075587 11:700156-700178 TGAGATAAAACAGCATTTGAAGG - Exonic
1078134087 11:8637932-8637954 ATAGATAGTTGAGGATTTGTGGG + Intronic
1080032315 11:27674826-27674848 AAATACAATACAGTATTTGTTGG + Intronic
1080686059 11:34515729-34515751 ATGAATAATATAGCATTTCTGGG + Intergenic
1081185549 11:40038091-40038113 ATGGATCATACAGGACTTGTGGG + Intergenic
1081944684 11:46979965-46979987 CATAATAATACAGCATTTGTAGG - Intronic
1082971419 11:59025991-59026013 ATTGAAAATACAGTATTTGCAGG + Intronic
1085578846 11:77632226-77632248 TAAAATAATACAGCTTTTGTAGG - Intronic
1088262826 11:107960485-107960507 ATAGATAAAACAACATGTGGAGG + Intronic
1088641056 11:111873222-111873244 ATAGATAAGGGAGCATTTGGGGG - Intergenic
1089408480 11:118218718-118218740 ATATAAAATTCAGAATTTGTGGG - Intronic
1089924686 11:122245269-122245291 ATGGATAATACAGCTTATGGGGG - Intergenic
1090681062 11:129057669-129057691 ATTGAAAATACAGTATTTGTGGG - Intronic
1090717321 11:129441893-129441915 ATAGATAAGACAGCATGTCAGGG + Intronic
1091044554 11:132314017-132314039 ATAGATAATACTTAATTTTTTGG - Intronic
1092598996 12:10038169-10038191 TTAAATAATTCAGCATTTCTTGG + Intronic
1092943484 12:13432153-13432175 ACAGGTAATTCAGCATTTCTAGG - Intergenic
1093285737 12:17258891-17258913 ACAGAATATACAGCATATGTTGG + Intergenic
1095193688 12:39287740-39287762 ATAAATAATTCAGGCTTTGTAGG - Intergenic
1096562475 12:52446574-52446596 AAAGATAAGAAACCATTTGTGGG + Intergenic
1097355642 12:58598203-58598225 ATAGAGAATAAAACAGTTGTGGG + Intronic
1098397042 12:70030164-70030186 ATACATAAGACAACATTTTTGGG + Intergenic
1098471581 12:70850991-70851013 ATAAATAAGCCAACATTTGTTGG + Intronic
1099287760 12:80736223-80736245 ATAGAAAATACAACCTTTTTTGG - Intergenic
1099460385 12:82913939-82913961 ACTGAAAATACAGTATTTGTGGG - Intronic
1101907002 12:108834515-108834537 ACAGAAAATACAGTATTTGAGGG + Intronic
1104191540 12:126486265-126486287 ATAGAAAACACAGTATTTGTGGG - Intergenic
1105422545 13:20265920-20265942 ATAGTAAATACAGCATTTATCGG + Intergenic
1105909269 13:24846182-24846204 ACAGATAATACAGCATTAGATGG - Intronic
1107019654 13:35738388-35738410 TTAGAAAATACAGCATTGGCTGG - Intergenic
1107269436 13:38597413-38597435 AGAGATAATGGAGCATTTTTAGG + Intergenic
1107288913 13:38829541-38829563 ATACATAAAATAGCATTTGGGGG + Intronic
1107397198 13:40030213-40030235 ATTGAAAATACAGTATTTGTGGG - Intergenic
1108533947 13:51353822-51353844 ATAAATAATACAGAACTTGCAGG - Intronic
1109090068 13:58030976-58030998 ATAGTTAATACTGAATTTGGTGG + Intergenic
1109626074 13:64976490-64976512 ATACCTAATACACTATTTGTTGG - Intergenic
1109735470 13:66478898-66478920 GTAGATAAAACAGCCTCTGTTGG + Intronic
1110285562 13:73746300-73746322 TTAGATATTACATCATATGTTGG - Intronic
1110962362 13:81643729-81643751 ACAGAAAAGACAGCATTTTTTGG + Intergenic
1111433077 13:88168983-88169005 ATTGAAAATACAGCATTTGAGGG - Intergenic
1113059801 13:106310219-106310241 ATATAAAATATAGCACTTGTAGG + Intergenic
1113113741 13:106852354-106852376 AAAGATATTCCAGCATTAGTAGG - Intergenic
1114971774 14:28039673-28039695 ATAGATAATACACCAACTGGAGG - Intergenic
1116451962 14:45077232-45077254 ATGTATAAGAAAGCATTTGTAGG + Intergenic
1116942412 14:50803718-50803740 ATAGATCATATAGCATTTTAGGG - Intronic
1117581881 14:57159381-57159403 TTAGATAACACAGGATTTGCTGG + Intergenic
1117711453 14:58533614-58533636 ATAGAGAAGGCAGCAGTTGTTGG - Intronic
1118427088 14:65677607-65677629 ATACCTAATACAGTATTTGCTGG - Intronic
1118711588 14:68523766-68523788 ATAGAAAATACAGCACTTGCAGG - Intronic
1119233990 14:73004445-73004467 ATATATAGTACATCATTTGGTGG - Intronic
1119913572 14:78373814-78373836 AGAGATAATACAGTATATGTGGG - Intronic
1120037592 14:79715609-79715631 AAAGATAATAAAGCAAGTGTAGG + Intronic
1120167162 14:81213497-81213519 ATAGAAGATGCAGCATTTTTAGG - Intronic
1120399567 14:84012097-84012119 ATAGATCATTCAACAATTGTTGG + Intergenic
1122391503 14:101390688-101390710 ATAGAAAATACAGCATTCACGGG + Intergenic
1122666193 14:103331956-103331978 ATACATAATAACACATTTGTGGG - Intergenic
1125004492 15:34801716-34801738 ATAGATAAGAATGAATTTGTAGG + Intergenic
1125196523 15:37053636-37053658 TTAAATAATACAGCACTTTTGGG - Intronic
1125987734 15:44071608-44071630 ATAGAGAACACAGCATTTTATGG - Intronic
1126701670 15:51373361-51373383 ATTGAAAATACAGTATTTGAGGG - Intronic
1127002430 15:54525286-54525308 CTAGATAACAAAGCCTTTGTTGG - Intronic
1130746321 15:86657646-86657668 ATAGAGGACACAGCATTTCTAGG - Intronic
1131530224 15:93184587-93184609 ATAGATAATACAGCCTGTAAAGG + Intergenic
1131974299 15:97928203-97928225 ATAGATAATAATAGATTTGTTGG + Intergenic
1134400312 16:13903871-13903893 ATAAATAATTCAGACTTTGTGGG + Intergenic
1135818694 16:25659533-25659555 ATAGTTAACACATTATTTGTTGG - Intergenic
1137941410 16:52691210-52691232 ATCAAAAATACAGTATTTGTAGG + Intergenic
1138026523 16:53526515-53526537 ATCAAAAATACAGTATTTGTGGG - Intergenic
1139142269 16:64280823-64280845 ATAAGTCATACAGCATTAGTAGG + Intergenic
1140226256 16:73079669-73079691 GGAGAGAATACAGCATGTGTAGG - Intergenic
1140581712 16:76238479-76238501 AAAGATAATACAGAATTTCAGGG + Intergenic
1141288969 16:82699847-82699869 ATAAATAATACAGCTTATGAAGG + Intronic
1144102569 17:11955293-11955315 ATAAATATTACAGGCTTTGTGGG - Intronic
1144521450 17:15955172-15955194 ATTGAAAATACAGTATTTGCGGG + Intronic
1149251267 17:54772320-54772342 AAAGATGAAAAAGCATTTGTTGG - Intergenic
1149275630 17:55031803-55031825 ATAAAAAATACAGTATTTGCAGG - Intronic
1155533638 18:26793671-26793693 ATAGATAATAATTCATTTTTAGG - Intergenic
1156026926 18:32665031-32665053 ATGGATAATAAATCAGTTGTAGG - Intergenic
1156913277 18:42436631-42436653 ATAAATAATTCTGCAATTGTTGG - Intergenic
1159704383 18:71668431-71668453 ATAGAGAACACACCATTAGTAGG + Intergenic
1163230873 19:16001300-16001322 ATGGTGAATACATCATTTGTAGG - Intergenic
1164034142 19:21438329-21438351 ATGGTAAATACATCATTTGTAGG - Intronic
1167521005 19:49955064-49955086 ATGGTAAACACAGCATTTGTAGG + Intronic
1168506046 19:56935961-56935983 ATAAAAAATACAACATTTGCCGG - Intergenic
925668783 2:6290069-6290091 AAGGCTGATACAGCATTTGTAGG - Intergenic
926974646 2:18502325-18502347 GTAGATATGACATCATTTGTAGG + Intergenic
927311032 2:21631443-21631465 ATAGAAAATAATGAATTTGTAGG + Intergenic
927375394 2:22407398-22407420 ATGGACAAGACAGCGTTTGTCGG + Intergenic
927759665 2:25741517-25741539 ATAGATTATTCAGCCTTTGCAGG - Intronic
927831642 2:26356324-26356346 ATAGATAGTAGAGCATTACTTGG + Intronic
927974926 2:27331099-27331121 ATAAATAATTCAGCAATTGGAGG + Intronic
929181459 2:39044655-39044677 ATCAAAAATACAGTATTTGTGGG + Intronic
929209842 2:39343651-39343673 ACTTATAATACACCATTTGTTGG + Intronic
929799517 2:45087647-45087669 ATGGATACTACAGCCTCTGTAGG - Intergenic
929823315 2:45290674-45290696 ATAGGTAATGCAGCAGGTGTTGG + Intergenic
932724960 2:74171448-74171470 ATAGATAAAACATCATGTCTGGG + Intronic
933060950 2:77735633-77735655 ATAGAAAATACAGTATTAGCGGG - Intergenic
933575829 2:84066318-84066340 ATAAATAAAACAGCATTTAAAGG + Intergenic
934061534 2:88298685-88298707 CAAAATAATTCAGCATTTGTTGG + Intergenic
935312668 2:101801001-101801023 TTAGATTATACAAAATTTGTTGG - Intronic
937015641 2:118602894-118602916 ATAGACACCCCAGCATTTGTAGG + Intergenic
937462191 2:122099095-122099117 TTTGATAATACACCCTTTGTTGG + Intergenic
939361796 2:141182290-141182312 ATAGATAAAAAAGCATTGGTAGG + Intronic
939486157 2:142813832-142813854 ATTGATAGGACAGCATTTTTTGG - Intergenic
939507399 2:143063951-143063973 ATATATTATTCAGCATTTCTAGG - Intergenic
939954315 2:148513264-148513286 ATAGAAAATACAGAATTTCATGG + Exonic
939959238 2:148551639-148551661 ATAGAAAATACAGAATTTCATGG - Intergenic
940173925 2:150858187-150858209 ATATATAAGACAGGATTTTTAGG - Intergenic
941116447 2:161478086-161478108 ATCAAAAATACAGTATTTGTGGG + Intronic
941617381 2:167736345-167736367 AAAGATAATTCAGCATGTCTGGG + Intergenic
941852721 2:170200334-170200356 CTAGGTAATAAAGCATCTGTTGG - Intronic
941872479 2:170400377-170400399 AAATATAATGCAGCATTTGCTGG + Intronic
941977491 2:171421701-171421723 ATTGAAAATACAGTATTTGGAGG + Intronic
942083253 2:172421609-172421631 ATTGAAAATACAGTATTTGCGGG + Intergenic
942798201 2:179846106-179846128 ATAGTAATTACAGCATTTTTAGG + Intronic
943783888 2:191855021-191855043 AGAAACAATACAGCATTTTTTGG + Intergenic
943929009 2:193825680-193825702 ATAGAATATACAGAATTTTTAGG + Intergenic
944002754 2:194860844-194860866 GTATATAATACATCATTTTTTGG - Intergenic
944868929 2:203890501-203890523 AGAGACAAAACAGGATTTGTAGG + Intergenic
947184398 2:227442071-227442093 AAAAAAAATACAGTATTTGTGGG - Intergenic
947716535 2:232342073-232342095 ATAGATAATAGAACATCAGTAGG + Intronic
1168997076 20:2141355-2141377 AAAGAAAATACAGGATTTCTCGG - Intronic
1170379090 20:15736719-15736741 ATGGAAAATACAGTATTTGAGGG + Intronic
1170940930 20:20847305-20847327 ATTGAAAATACAGCATTCGAGGG - Intergenic
1170980411 20:21207059-21207081 ATATATAATACAGGATTTTCTGG + Intronic
1173726757 20:45303838-45303860 ACAGATCTTGCAGCATTTGTGGG + Intronic
1177122752 21:17158232-17158254 ATGGAAAATACAGCCTTCGTGGG + Intergenic
1178049487 21:28732412-28732434 AAAGATAATACAGCATGTGCTGG + Intergenic
1178768556 21:35479381-35479403 ATTGATAATGGAGTATTTGTTGG - Intronic
1179423532 21:41254794-41254816 AGAGAGAAGACAGCATCTGTGGG - Intronic
1180911344 22:19453022-19453044 CTAAATAATAGAGGATTTGTGGG - Intronic
1183967443 22:41450597-41450619 ATATATAAAAAATCATTTGTCGG - Intergenic
1203293066 22_KI270736v1_random:14038-14060 CTGGATAAGACAGCATTTGGAGG - Intergenic
951106223 3:18746473-18746495 ATTGATAATGCAACATTTCTTGG - Intergenic
951699389 3:25479703-25479725 AGAGATAATAAAGCCTTGGTAGG - Intronic
954839095 3:53495424-53495446 AGAGTTAATTCTGCATTTGTGGG + Intronic
956735844 3:72237482-72237504 ATTGAAAATACAGAATTTGCAGG - Intergenic
958686101 3:97397506-97397528 ACAGAAAATCCAGCATTTGGGGG + Intronic
959109375 3:102103814-102103836 TTTGAAAATACAGTATTTGTGGG + Intronic
959378759 3:105616877-105616899 ATAAATAATACAGCACTGGTAGG + Intergenic
959813680 3:110650236-110650258 ATAGGAAATACAGCAGATGTAGG + Intergenic
959853157 3:111114825-111114847 ATAGAGAATAGAGTATTTGTAGG + Intronic
960354791 3:116637923-116637945 GTAGTTAATACAGCACATGTTGG - Intronic
961158251 3:124699580-124699602 ATAGATAATACAGAATTTACAGG - Intronic
961715918 3:128857385-128857407 ATGGTGAACACAGCATTTGTAGG - Intergenic
962551661 3:136499079-136499101 ATTGAAAATACAGTATTTGTGGG - Intronic
963138132 3:141926350-141926372 GTAGATAAAATAGCATTTTTAGG + Exonic
963534365 3:146509944-146509966 ATAGATAATTCAACAATTTTAGG + Intergenic
963839772 3:150093432-150093454 ATCAAAAACACAGCATTTGTGGG + Intergenic
964279077 3:155042973-155042995 ATAGAAAAATCACCATTTGTAGG + Intronic
964926942 3:161970678-161970700 ATTGAAAATACAGTATTTGTGGG - Intergenic
964948864 3:162262372-162262394 ATAAATAATACAGCTGTGGTGGG + Intergenic
965273308 3:166647410-166647432 ATAGATAAACCATCAGTTGTAGG + Intergenic
967453707 3:189655923-189655945 ATGGATAATAGGTCATTTGTGGG - Intronic
967726585 3:192867994-192868016 AGAAATCATACAGCAATTGTAGG + Intronic
968290667 3:197536888-197536910 ACACATAACACAGCATGTGTAGG - Intronic
970121746 4:12761665-12761687 ATAGATATTTCAGGCTTTGTGGG - Intergenic
971604218 4:28636615-28636637 ATAGAAAATACAGTATTTGTGGG - Intergenic
972086253 4:35220562-35220584 AGATATAAACCAGCATTTGTTGG - Intergenic
972113268 4:35593184-35593206 ATTGAAAATACAGTATTTGTGGG + Intergenic
972319923 4:37964235-37964257 TTAGTTAAAGCAGCATTTGTTGG + Intronic
972479763 4:39486216-39486238 ATGGTGAACACAGCATTTGTAGG + Intergenic
973849977 4:54951857-54951879 GTAGATAAAACAGCCTTTTTTGG - Intergenic
974318431 4:60312086-60312108 ATAGAAAATAAAGTATTTGTTGG - Intergenic
974318672 4:60315114-60315136 ATAGAAAATACAGTATATGCAGG - Intergenic
974376880 4:61089508-61089530 CTAGATTATACCACATTTGTAGG + Intergenic
975224060 4:71849078-71849100 ATAGAAAATACAGTATTCTTGGG + Intergenic
975956281 4:79844143-79844165 ATAGATAATATAGCAATTCTGGG + Intergenic
976237625 4:82915810-82915832 AGAGAAAATACAGTATTTATAGG - Intronic
976407704 4:84678591-84678613 ATAAATAAAACTGCATTTGCAGG - Intronic
976773552 4:88681652-88681674 AAAGAAAATACAGTATTTGCAGG - Intronic
978407361 4:108394681-108394703 ATAGATAATACTGCACTTTGTGG - Intergenic
978984413 4:114992617-114992639 ATAGAAAATACAGTATTTACAGG + Intronic
979202875 4:117999762-117999784 ATAAATGATAAATCATTTGTGGG + Intergenic
979514320 4:121589494-121589516 TTAGATCATTCAGCATATGTTGG - Intergenic
979572474 4:122244401-122244423 ATTCAGAATACAGTATTTGTGGG - Intronic
980243388 4:130204512-130204534 ATAGAAATTACAGTATTTGTGGG + Intergenic
980569162 4:134588169-134588191 ATAGAAAATACAGTACTCGTCGG - Intergenic
980594368 4:134934028-134934050 TTAGATAATTCAGCATTTATTGG - Intergenic
981249424 4:142582016-142582038 CTAGCTAATACAGCAGTTGCTGG - Intronic
981526946 4:145716083-145716105 ATAGATAATAGATAATTTGGGGG - Intronic
981632653 4:146838714-146838736 ATCGAAAATACAGTATTTGAAGG + Intronic
981658382 4:147137956-147137978 AGAGAAAATACAGCATTTATAGG + Intergenic
982339368 4:154279091-154279113 ATTGATAATATAGAATGTGTTGG + Intronic
983485215 4:168324474-168324496 ACAGATTTTACAGCATTTGTTGG + Intergenic
984049589 4:174847280-174847302 ATAGATGATACATTATCTGTTGG + Intronic
984829953 4:183963724-183963746 AGAAATAATACAACATTTTTAGG - Intronic
984890422 4:184487156-184487178 AGAAACTATACAGCATTTGTAGG - Intergenic
985865073 5:2508317-2508339 AAAGATTATACATTATTTGTAGG - Intergenic
987001104 5:13661054-13661076 ATAAATAAGTCAGCATTTATGGG - Intergenic
987056913 5:14202183-14202205 ATAGATAACCCAGCATTGCTAGG + Intronic
987167026 5:15209855-15209877 ATATATAATATAGAATTTCTGGG - Intergenic
987544138 5:19290497-19290519 ATTGATAATGCAGTATTTCTTGG + Intergenic
989292290 5:39782868-39782890 ATAGATAATTTAAAATTTGTGGG + Intergenic
990080324 5:51904571-51904593 ATGGATAATACCACATATGTAGG - Intergenic
990149749 5:52802668-52802690 ATAAATAATATAGCATGTTTTGG - Exonic
990207267 5:53442808-53442830 ATAGATAATATAGCCTTTGGAGG - Intergenic
990635372 5:57720204-57720226 GTAATTAATACAGAATTTGTGGG + Intergenic
990964496 5:61430592-61430614 ATTGAAAATACAGCATATGGGGG + Intronic
992244710 5:74808605-74808627 ATACATAATACCTTATTTGTAGG - Intronic
992263886 5:74998103-74998125 ATTGAAAATACAGTATTTGAGGG - Intergenic
992607079 5:78469037-78469059 ATAGAAAATACAGTATTCATGGG - Intronic
992665747 5:79007311-79007333 ATAGAAAATACAGTATTCGTGGG + Intronic
993799574 5:92316072-92316094 ATAGATGATAGAGTATGTGTTGG - Intergenic
994253175 5:97561117-97561139 AGATATAATACTGCATTTGCTGG + Intergenic
994899435 5:105751546-105751568 ATAAAAAATTCAGCATATGTTGG + Intergenic
996103256 5:119467681-119467703 ATAGAAAATACAGTATTCATAGG + Intronic
996735233 5:126752170-126752192 ATAGATACTACACATTTTGTGGG + Intergenic
997502586 5:134388375-134388397 ATAGAAGATACATCATATGTTGG - Exonic
997705402 5:135946662-135946684 ATGGATAATAAAGGATTTGCTGG - Intronic
999016993 5:148117693-148117715 ATAAAAAATACAGGATTTGTGGG + Intronic
1000401360 5:160831449-160831471 GTACATAATACTTCATTTGTGGG + Intronic
1000903672 5:166937149-166937171 AGAGGTTTTACAGCATTTGTGGG + Intergenic
1000959926 5:167587729-167587751 TTAGCTAATACAGCTTTTTTCGG + Intronic
1001327082 5:170736857-170736879 ATAGAAAATGCAGTATTTATAGG - Intergenic
1002818512 6:700462-700484 ATAGATAATACTGTATTTACAGG - Intergenic
1002957383 6:1879831-1879853 AGAGATAGTACAGCCTTTCTAGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003520307 6:6852970-6852992 ATGGAAAATACAGTATTGGTGGG - Intergenic
1003900790 6:10653629-10653651 ATGGAAAATACAGTATTTGTGGG - Intergenic
1004503554 6:16229545-16229567 ATGGTAAACACAGCATTTGTAGG - Intergenic
1004568189 6:16819330-16819352 TGAGATAATACAGAATTTGAGGG - Intergenic
1005524141 6:26629032-26629054 ATGGAAAATACAGTATTTGTGGG + Intergenic
1005588858 6:27303924-27303946 ATAAATAAACCAGAATTTGTTGG - Intronic
1005599004 6:27407191-27407213 ATAGATAACAGAACACTTGTGGG + Intergenic
1006560493 6:34907490-34907512 ATAAAAAATATAGCGTTTGTGGG - Intronic
1008204188 6:48632989-48633011 ATAAAAGATAAAGCATTTGTAGG - Intergenic
1008600993 6:53094621-53094643 ATAATTAATACAGCTTTTGAAGG + Intronic
1010695454 6:78968425-78968447 ATTGAAAATACAGTATTAGTGGG + Intronic
1011408337 6:87039331-87039353 ATCAATAGTACAGCATTTGGGGG - Intergenic
1011667215 6:89646135-89646157 ATTGAAAATTCAGCATTTGAGGG - Intronic
1012266066 6:97144387-97144409 ATCTAAAATACAGTATTTGTGGG - Exonic
1012501192 6:99889639-99889661 ATAGATGCTACTGCATCTGTCGG + Intergenic
1012722239 6:102759243-102759265 GTAGGTATTACAGAATTTGTAGG + Intergenic
1014095728 6:117458503-117458525 TTGGATAATACAACATTTGGTGG - Intronic
1016112794 6:140246620-140246642 ATGGAAAATACAGGATTAGTGGG + Intergenic
1016283145 6:142442410-142442432 ATAGATAATAGAGCATAAGTGGG + Intronic
1016503656 6:144751614-144751636 ATGGAAAATACAGTATTTGCAGG - Intronic
1016635442 6:146283894-146283916 ATAGATAATACAGAAACAGTTGG + Intronic
1016845914 6:148568278-148568300 ATATATAATATAAAATTTGTGGG - Intergenic
1017262006 6:152398183-152398205 ATAGATATTACAGGTTTTATAGG - Intronic
1017315284 6:153024124-153024146 GTAGATAATTCAGCTTCTGTTGG - Intronic
1017737421 6:157378103-157378125 ATGGAAAATACAGCATCCGTGGG - Intergenic
1020060585 7:5148872-5148894 ATAGAAAATACAGTATTTGAGGG + Intergenic
1021088024 7:16447001-16447023 AGAGGGAATACAGCATGTGTCGG - Intergenic
1021098994 7:16566952-16566974 ATAGATAATATAGCATTTGGGGG - Intronic
1023664799 7:42511981-42512003 ATAGACACAACAGCATCTGTTGG + Intergenic
1024429908 7:49275835-49275857 ATTGTTAATTCATCATTTGTAGG + Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1024948825 7:54837634-54837656 ATAGATAATACTGTTTTTGCTGG + Intergenic
1027736966 7:81944544-81944566 TTAGATAATAAATCATTTGGGGG + Intergenic
1027841524 7:83318150-83318172 ATATATAATAAAGCATATGTTGG - Intergenic
1027875136 7:83759343-83759365 ATAGAAAATACAGAAAATGTTGG - Intergenic
1028106416 7:86884462-86884484 ATTGAAAATACAGCATTGGTGGG + Intronic
1029659716 7:101951941-101951963 ATAGATAATACAAAAATGGTGGG + Intronic
1034145923 7:148871558-148871580 AAAGAAAATACACTATTTGTGGG - Intronic
1035946282 8:3966800-3966822 ATAGAAAATACATTATTTCTTGG - Intronic
1036069910 8:5429902-5429924 ATAAAAAATACAGTATTTGTGGG - Intergenic
1037165975 8:15829019-15829041 ATAGATAAAACAGCATGAGTGGG - Intergenic
1038125094 8:24664555-24664577 ATAGATACTTCAGTATTTGGAGG - Intergenic
1038346016 8:26733290-26733312 ATTGAAAATACAGCATTTGTCGG + Intergenic
1038346061 8:26733610-26733632 AAAGAAAATACAGCATTTGTGGG + Intergenic
1039241382 8:35560695-35560717 AGAGATAATATACCTTTTGTGGG + Intronic
1040388021 8:46926765-46926787 ATAGCTAGTAAAGCATTTTTGGG - Intergenic
1040697708 8:50022265-50022287 ATATCTATTACAGCATTTATAGG - Intronic
1040880860 8:52202833-52202855 ATTGAAAAAACAGAATTTGTTGG + Intronic
1041276073 8:56158696-56158718 GTAGATAATCAAGTATTTGTTGG - Intergenic
1041284444 8:56245747-56245769 ATGGAAAATACAGTATTTCTGGG + Intergenic
1041573521 8:59366181-59366203 ATAGATAAGAAAGCCTTTGATGG + Intergenic
1042074566 8:64977591-64977613 ACAAATTATAAAGCATTTGTTGG + Intergenic
1042287466 8:67130043-67130065 ATAGAAAGTACAATATTTGTGGG + Intronic
1043089529 8:75880506-75880528 ATAGATAATATAGTATTGGGAGG - Intergenic
1043455664 8:80409505-80409527 AAAGAAAATACAGTATTCGTAGG + Intergenic
1043573346 8:81629987-81630009 TTAGATCATACAGATTTTGTGGG - Intergenic
1047808981 8:128387162-128387184 ATGGATAATTCAGCAATTGCAGG + Intergenic
1048022524 8:130553208-130553230 ATAGATAATACAACTTTGGGAGG - Intergenic
1049049996 8:140187178-140187200 GTGGAAAATACAGTATTTGTGGG + Intronic
1051821683 9:21177699-21177721 ATAGAAAATACAGCATTTGTGGG - Intergenic
1052755566 9:32537455-32537477 ATAGACAAAAAAGCATTTGTGGG - Intergenic
1055602700 9:77936322-77936344 ATAATTCAGACAGCATTTGTTGG - Intronic
1056344772 9:85680931-85680953 ATAGAAAATAAAGCATTAGCTGG - Intronic
1056480157 9:86995075-86995097 GTCTATAACACAGCATTTGTAGG - Intergenic
1059140707 9:111850557-111850579 CTGCATCATACAGCATTTGTAGG - Intergenic
1059674273 9:116522853-116522875 AGAGATAATACAGAATTTAGTGG - Intronic
1060124729 9:121032350-121032372 ATAAATAATTGAGCATTTTTAGG + Intronic
1060310041 9:122451672-122451694 ACAGGTAATAAAGAATTTGTAGG - Intergenic
1060592357 9:124826139-124826161 ATAAATAATAAGTCATTTGTTGG + Intergenic
1185742847 X:2547685-2547707 TTACATAATACAGCTTTTGCGGG - Intergenic
1186283772 X:8022455-8022477 ACAGATAATACAGCTTTATTGGG + Intergenic
1186538195 X:10371669-10371691 ATTGAAAATACAGAATTTGAGGG + Intergenic
1187489014 X:19732463-19732485 ATAGATAATACAGCATTTGTGGG - Intronic
1187967694 X:24628960-24628982 ATAAATGATACAGCTTTTGTAGG - Intronic
1188226367 X:27602906-27602928 ATAGACAATACTGAATTTATTGG - Intronic
1188645640 X:32563439-32563461 ATAGACAAGAAAGCATTTGAGGG - Intronic
1188659374 X:32739580-32739602 AGAAATAATACAGCAATTTTGGG + Intronic
1192838520 X:74828308-74828330 ATACATGATACAGCAGTTGTAGG + Intronic
1193206500 X:78754496-78754518 ATAGTTAAAACAGCATTTATGGG - Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194967242 X:100302566-100302588 ATAGAAAATACAACATCTGTGGG + Intronic
1195457926 X:105090335-105090357 ATAGAAAATACAGTATTTGCAGG - Intronic
1196130760 X:112153047-112153069 ATAAATAATAAATAATTTGTTGG + Intergenic
1196316637 X:114233790-114233812 ATCGAAAATACATTATTTGTGGG - Intergenic
1196919568 X:120571805-120571827 ATGGAAAATACAGGATTTGCAGG + Intronic
1196962788 X:121022073-121022095 ATACATAAAACAGCCTTTGTTGG - Intergenic
1197300646 X:124775856-124775878 ATAGAAAATACAGTATTCATGGG + Intronic
1197998835 X:132410954-132410976 ATAGATGATACAATATTTGGAGG - Intronic
1198317119 X:135479102-135479124 ATAACTAATACAGCATTCCTTGG - Intergenic
1198748750 X:139917993-139918015 ATAAAAAATATAGCAATTGTTGG + Intronic
1199239917 X:145534562-145534584 CCAAATCATACAGCATTTGTGGG + Intergenic
1200426145 Y:3022475-3022497 ACAGCTAATGCAGCCTTTGTAGG - Intergenic
1201247583 Y:12021024-12021046 AAAGAACACACAGCATTTGTGGG - Intergenic
1201442343 Y:14022019-14022041 ATAGATAATACAGCTTTATTGGG - Intergenic
1202168211 Y:22014722-22014744 ATAGTAAATGCAGCATTTGTAGG + Intergenic
1202223150 Y:22571646-22571668 ATAGTAAATGCAGCATTTGTAGG - Intergenic
1202319965 Y:23624014-23624036 ATAGTAAATGCAGCATTTGTAGG + Intergenic
1202550803 Y:26046042-26046064 ATAGTAAATGCAGCATTTGTAGG - Intergenic