ID: 1187489715

View in Genome Browser
Species Human (GRCh38)
Location X:19739612-19739634
Sequence GGGGTATCACAGATAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187489707_1187489715 21 Left 1187489707 X:19739568-19739590 CCTTTTTTTTTTTTAATCCTCAT 0: 1
1: 1
2: 41
3: 355
4: 2558
Right 1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1187489709_1187489715 4 Left 1187489709 X:19739585-19739607 CCTCATTAACAATAATCCTGGTC 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187489715 Original CRISPR GGGGTATCACAGATAGAACA AGG Intronic
907593908 1:55702255-55702277 AGGGTATGACAGAGAGCACAAGG + Intergenic
911745854 1:101441338-101441360 GGCTTCTCACAGATAGTACAGGG + Intergenic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
913671348 1:121099169-121099191 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914023117 1:143886589-143886611 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914661603 1:149794531-149794553 GGGGAAGTACAGATAGAAAAAGG + Intronic
920277593 1:204819011-204819033 GGGGTATCAGTGCTATAACAAGG - Intergenic
1066369379 10:34807113-34807135 GGGGTAGCACACAGAGACCAGGG + Intronic
1066748300 10:38625460-38625482 GGGGTATCACACATGGAATTTGG - Intergenic
1066968382 10:42292313-42292335 GGGGTATCACACATGGAATTTGG + Intergenic
1070507874 10:77131446-77131468 GGCGTAACACTGAGAGAACAAGG + Intronic
1080601024 11:33820643-33820665 GGGGTATAACTGATGGAAAAAGG - Intergenic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1085270419 11:75266830-75266852 GGGGGATCCCAGACAGAAGAAGG + Intronic
1090652431 11:128819307-128819329 GGGGCATCAGAGCTTGAACAGGG - Intergenic
1091010815 11:131998749-131998771 GGGGTATAACAGATATACCAAGG - Intronic
1092048316 12:5449172-5449194 GGGATAGCACAGACAGCACAGGG + Intronic
1092217822 12:6695030-6695052 GGGGCATCACAGATTCACCAGGG + Exonic
1097278051 12:57826543-57826565 GGGGTATCACATCTTGAACTAGG - Intronic
1098020770 12:66154155-66154177 GGGATATCACAGAGAGAAGGTGG - Intronic
1099986691 12:89673831-89673853 GGGGTGTCACAGCTAGCACTGGG + Intronic
1102663816 12:114552391-114552413 GGAGTATCACAGGAAGACCACGG + Intergenic
1102850252 12:116236365-116236387 GAGATATCACAGATAAAAAATGG + Intronic
1103871323 12:124094454-124094476 TGGGGAACACAGAGAGAACACGG + Intronic
1104679924 12:130742807-130742829 GAGGGATGACAGATAGAAGATGG + Intergenic
1106954805 13:34924710-34924732 GGAGTACCACAGGTAGAACGAGG + Intergenic
1109384090 13:61604642-61604664 GTGGGAACACAGATAGAAGATGG + Intergenic
1110769629 13:79325876-79325898 AGGGTATAAAAGATAAAACATGG - Intronic
1110807537 13:79774397-79774419 GGGGTATCAGAGGTGGAAGAGGG + Intergenic
1119805654 14:77480419-77480441 GGGGTTTCACAGAAAGCACTGGG - Intronic
1120024510 14:79567884-79567906 GGTGAATCACAGATAGACCAGGG + Intronic
1122811060 14:104288187-104288209 AGGAGATCAAAGATAGAACATGG - Intergenic
1128721511 15:69954008-69954030 GGGGTCACACAGATAGGAAATGG + Intergenic
1128894084 15:71356942-71356964 GGGGTAGCAGAGAGAGACCATGG + Intronic
1132225542 15:100138068-100138090 GGCCTATCTCAGATAGAACAAGG + Intronic
1132288424 15:100682731-100682753 GGGCTATCAAAAATAGAACCAGG - Intergenic
1133477265 16:6135501-6135523 GAGGGATCACAGATTCAACAGGG + Intronic
1138051276 16:53781271-53781293 GTGGCATAACAGAAAGAACATGG - Intronic
1138116817 16:54367463-54367485 TGGGTGTCAGAGATGGAACAAGG + Intergenic
1139928159 16:70503549-70503571 GGAGTATTCCAGATAGAGCAAGG - Intronic
1140783747 16:78319756-78319778 GGGGTAGCACAGAGAGACCTCGG - Intronic
1141912206 16:87067735-87067757 GGGGTAACACAGTCAGAAAAAGG - Intergenic
1144041074 17:11411721-11411743 AGGGTATCACAGATTGCCCAAGG + Intronic
1149483374 17:57021786-57021808 GGAGTATCACACAGAGAACCTGG + Intergenic
1150938493 17:69663234-69663256 GGGGCATCACAGAGAGCAGATGG + Intergenic
1158136162 18:54210690-54210712 GGGGTGTCACAGATGGCAGATGG + Intronic
1158313743 18:56188049-56188071 GAGGTTTCAGAGATTGAACAGGG + Intergenic
1158574677 18:58626170-58626192 GGGGTATCTCAGTAAAAACAAGG + Intronic
1159378277 18:67622570-67622592 GGGTTCTCATAGATAGAATAAGG - Intergenic
1161271568 19:3392605-3392627 GGGGCATCACAGGTGCAACAAGG - Intronic
1162262232 19:9542572-9542594 GGGGTCCCACAGATGGGACATGG - Intergenic
1163192778 19:15690767-15690789 GAGGCATCACAGATAGACAAGGG + Intronic
1163671649 19:18632833-18632855 GGGGTAACAGAGAGAGATCATGG + Intergenic
1163991900 19:21006662-21006684 GGGATATCACAGAGAGAGCTTGG - Intergenic
1164694876 19:30235920-30235942 AGCGTCTCACGGATAGAACATGG + Intronic
1167596133 19:50429088-50429110 GGAGGATCCCAGATATAACAAGG - Exonic
925133292 2:1509563-1509585 GGGGTATCCCCGAAAGAAGAGGG - Intronic
929747199 2:44671296-44671318 TGGGTATCACAAATAGGACTGGG - Intronic
930807378 2:55504458-55504480 GGGTTATCACATATAGACAAAGG - Intergenic
934076245 2:88430977-88430999 GTGTTGTTACAGATAGAACAAGG - Intergenic
937244671 2:120485032-120485054 GGGGCATCACAGAAAGAGCAAGG - Intergenic
938581944 2:132654441-132654463 CGTGTAGCACAGAAAGAACATGG - Intronic
942219871 2:173758483-173758505 GGGGCATGACAGACAGAACAGGG + Intergenic
944673236 2:202013892-202013914 TGGGTTACACAGATAGTACATGG + Intergenic
945575023 2:211519966-211519988 GAGGTATCACTGATAGATAAGGG - Intronic
945610544 2:211995848-211995870 GTGCTATCATAGATAGAATATGG - Intronic
1169141571 20:3229926-3229948 GGGGTGTCAGAGATGGGACAGGG - Intronic
1175385078 20:58589644-58589666 GAGGCATCACAGCTAGTACATGG - Intergenic
1178359894 21:31940296-31940318 TGGGTATTAGAGATAGACCATGG - Intronic
1181298754 22:21863881-21863903 GGGATTTCTGAGATAGAACAAGG - Intronic
1184157891 22:42680595-42680617 GGGGTATCTCAGAGACAATAAGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
953612871 3:44462146-44462168 GGACTATCACAGATAGAACGTGG + Intronic
954946330 3:54427845-54427867 AGGGTATCACAGAGAAAACAAGG - Intronic
960136924 3:114114936-114114958 GAGGTATCATTGATAGAAAAAGG + Intergenic
960450506 3:117801156-117801178 GGGGCCACTCAGATAGAACAAGG - Intergenic
960589884 3:119355120-119355142 GTGGTATCACAGAAAAAGCATGG + Intronic
965403215 3:168238386-168238408 GGAGTAGCACAGATAGAAATGGG + Intergenic
965972102 3:174571990-174572012 GCGGTATCATAAAAAGAACAGGG - Intronic
967657573 3:192070200-192070222 GAAGTATCACAGATTGAAGACGG + Intergenic
980092676 4:128458677-128458699 TAGGTAACACAGCTAGAACATGG - Intergenic
984365170 4:178790273-178790295 GGGGTGTCACATATAGACAAAGG + Intergenic
986415703 5:7526005-7526027 GGGGTATCAGAGCTGGGACAGGG - Intronic
986839087 5:11675284-11675306 TGGGTATCACGGTTAAAACAGGG - Intronic
988347331 5:30055501-30055523 GAGGTTTCTCAGATAGAACTAGG - Intergenic
990641524 5:57790835-57790857 GAGGTATCATAGAAAGAATAGGG - Intergenic
994889925 5:105620472-105620494 GGGGTATGACAGAAATAAAAAGG + Intergenic
999717699 5:154375102-154375124 GGGGAAACACAGCTAGAAGAAGG + Intronic
1000234596 5:159345712-159345734 GGGGCATCACTGAAAGAACTGGG - Intergenic
1000262107 5:159597956-159597978 GGGGTATGAAAGAAAGAATAAGG - Intergenic
1003379778 6:5613958-5613980 GGAGCATCGCAGATAGCACATGG + Intronic
1004755131 6:18602333-18602355 GGGGCATCAGAGATAAACCAGGG + Intergenic
1006466424 6:34197200-34197222 GAGGAATCATAGAAAGAACAGGG + Intergenic
1016409043 6:143762463-143762485 AGGCTATCACAGAGAAAACAGGG + Intronic
1016596145 6:145803645-145803667 AGGGTATCACAGAAGGAAAATGG + Intronic
1017864930 6:158435055-158435077 GGGGTATCAGAGATGACACAGGG - Intronic
1019062937 6:169269788-169269810 GGGACAGCACAGATAAAACAGGG - Intergenic
1020716195 7:11676660-11676682 AGGATATCAGAGATAGAAGATGG + Intronic
1022564546 7:31384867-31384889 GGGGTAACACAGATGAGACAGGG - Intergenic
1033960966 7:146912593-146912615 GGGATATTACAAATAAAACATGG - Intronic
1035217930 7:157383816-157383838 TGGGTTTCAAAGATGGAACATGG + Intronic
1040397453 8:47013163-47013185 GGGGAATCACAAACAGAACTAGG - Intergenic
1041243394 8:55868687-55868709 TGGGTTTCACAGATAATACATGG + Intergenic
1044529896 8:93294991-93295013 GTGGCATCCCAGACAGAACAGGG + Intergenic
1046847764 8:118937333-118937355 GGGGTTCCACAAATAAAACAAGG - Intronic
1047137235 8:122093706-122093728 AGGGAATCACAGATTGAACTGGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056771904 9:89483669-89483691 GGGGTGTCACAGATAGTTAAGGG + Intronic
1059500958 9:114753747-114753769 GGGGTATGACATAGAGAAGAAGG + Intergenic
1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG + Intronic
1187541154 X:20196828-20196850 GGGGCATATCAGATATAACAAGG - Intronic
1194180260 X:90702904-90702926 GTGGAATCATAGATAGTACATGG - Intergenic
1197311027 X:124905638-124905660 GGGGGATCACAGGTAGAGCCTGG + Intronic
1199697361 X:150352316-150352338 GTGGTTTCACAGATAGACCAGGG + Intergenic
1200526918 Y:4285064-4285086 GTGGAATCACAGATAGTACATGG - Intergenic