ID: 1187492980

View in Genome Browser
Species Human (GRCh38)
Location X:19769991-19770013
Sequence CTGAATCTAAAAATGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2490
Summary {0: 1, 1: 1, 2: 56, 3: 420, 4: 2012}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187492976_1187492980 13 Left 1187492976 X:19769955-19769977 CCAAGGGTTCTCACTCTCGGATT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG 0: 1
1: 1
2: 56
3: 420
4: 2012

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187492980 Original CRISPR CTGAATCTAAAAATGGGCAA AGG Intronic
Too many off-targets to display for this crispr