ID: 1187495959

View in Genome Browser
Species Human (GRCh38)
Location X:19796034-19796056
Sequence CCTGACAAGCATCTGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187495954_1187495959 14 Left 1187495954 X:19795997-19796019 CCACCAATCGGTGGGCCACGTAA 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1187495959 X:19796034-19796056 CCTGACAAGCATCTGTTGAATGG 0: 1
1: 0
2: 1
3: 15
4: 121
1187495955_1187495959 11 Left 1187495955 X:19796000-19796022 CCAATCGGTGGGCCACGTAATCA 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1187495959 X:19796034-19796056 CCTGACAAGCATCTGTTGAATGG 0: 1
1: 0
2: 1
3: 15
4: 121
1187495957_1187495959 -1 Left 1187495957 X:19796012-19796034 CCACGTAATCAGTTTAGAAGGTC 0: 1
1: 0
2: 0
3: 6
4: 30
Right 1187495959 X:19796034-19796056 CCTGACAAGCATCTGTTGAATGG 0: 1
1: 0
2: 1
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187495959 Original CRISPR CCTGACAAGCATCTGTTGAA TGG Intronic
901379814 1:8865538-8865560 CCTGTGTAGCAGCTGTTGAAGGG - Intronic
902385914 1:16075840-16075862 CTTTATATGCATCTGTTGAACGG - Intergenic
904277059 1:29391601-29391623 CCTCACAAGCAGCTGATGACAGG + Intergenic
906719524 1:47995569-47995591 CCTGACTTGGATCTGTAGAAAGG - Intronic
910430333 1:87153642-87153664 CTTGATAACCAGCTGTTGAATGG + Intronic
911252410 1:95592161-95592183 CCTGAAAACTATTTGTTGAATGG - Intergenic
915462729 1:156079902-156079924 CCAAAGAAGCATCTCTTGAAGGG + Intronic
918102986 1:181392577-181392599 CCTGACCAACATCTGTGGAAGGG + Intergenic
918377142 1:183920621-183920643 CCTGACATGCATCCCCTGAAGGG + Intronic
920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG + Intergenic
921928005 1:220728898-220728920 GCTGAAAAGCATATTTTGAATGG - Intergenic
1063568926 10:7196650-7196672 CCTGACAAACATTTGTTCAATGG + Intronic
1064647987 10:17479534-17479556 CCTGACATCCATCAGTTTAATGG - Intergenic
1070978159 10:80622247-80622269 CTTCACATGTATCTGTTGAAAGG + Intronic
1071389667 10:85159655-85159677 CCTGCCAAGCATATTTTTAAAGG - Intergenic
1072107945 10:92291508-92291530 CCTGTCCAGCATCTGCTGTAGGG - Exonic
1072542512 10:96409193-96409215 CCTGACAAGTATTTGTTGAATGG - Intronic
1076517466 10:131055996-131056018 CATGACAAAAATCTGTTGAAAGG - Intergenic
1077137142 11:1006154-1006176 CCTGCCAAGCATCTTTTCCAGGG - Intronic
1077716699 11:4588397-4588419 CCTGAGCATCATCTGTGGAAAGG - Intergenic
1078186306 11:9054642-9054664 CATGCCAAGGATGTGTTGAAAGG + Intronic
1079950684 11:26799910-26799932 TCTTACCACCATCTGTTGAATGG - Intergenic
1082145772 11:48666570-48666592 GCTGAAAAGCATTTGCTGAATGG - Intergenic
1083036162 11:59639529-59639551 TCAGACAAGCATGAGTTGAAAGG + Intronic
1084422139 11:69065807-69065829 CCTGAGAAACATCTGTAAAATGG - Intronic
1088675264 11:112186588-112186610 GCTGACATGGATCTGTTAAATGG - Intronic
1094310125 12:29071117-29071139 CCCAAGAAGCAGCTGTTGAAAGG - Intergenic
1100575845 12:95890847-95890869 CCTGAGAAGCATCTTCTGAAAGG + Exonic
1100586111 12:95981261-95981283 CCATAGAAGAATCTGTTGAATGG + Intronic
1101244849 12:102875542-102875564 CCAGACAGAGATCTGTTGAACGG + Intronic
1101411850 12:104475447-104475469 TTTAACAAGCATTTGTTGAATGG + Intronic
1103624489 12:122207543-122207565 CTTGTCCAGCATATGTTGAATGG + Intronic
1104731189 12:131106282-131106304 GCTGTCAAGCAGCTGATGAAGGG - Intronic
1105421970 13:20261030-20261052 CCTGACAAACCTTTGTTGAGTGG - Intergenic
1105995980 13:25672286-25672308 CCTTACAAGGATAAGTTGAAAGG - Intronic
1107788834 13:43980475-43980497 TTTGTCAAGCATCTGCTGAATGG - Intergenic
1109442045 13:62387273-62387295 CTTGAAAAGCATTTGCTGAATGG - Intergenic
1110187194 13:72689087-72689109 CCTTAAAAGCATCTGGGGAAAGG + Intergenic
1111518180 13:89362915-89362937 CCTGCCGACCATCTGTTGATTGG + Intergenic
1121712270 14:96047530-96047552 CCTCAAAGGCATCTGTTGAATGG - Intronic
1124627613 15:31317758-31317780 CCTGCCAAGCCTCTGATCAATGG - Intergenic
1124932962 15:34141047-34141069 CCTGACAGGCATCTGAGCAAAGG - Exonic
1129336458 15:74854763-74854785 CCTGAGAAGCCTCTCTGGAAGGG + Intronic
1137251368 16:46743308-46743330 CATGGCAACCATCTGTGGAATGG - Intronic
1139554337 16:67697069-67697091 CCTGACCAGCATGTGGTGATGGG - Intronic
1140947105 16:79779082-79779104 AATCAGAAGCATCTGTTGAATGG + Intergenic
1146985107 17:37208612-37208634 CATGACAAGCAGCTGCTAAACGG + Intronic
1149199742 17:54169589-54169611 CCTCACAAGAATCTATTGAAAGG + Intergenic
1153733860 18:8044193-8044215 CCTGACAAGAGTTTGTTCAAGGG + Intronic
1157993048 18:52520402-52520424 CCTGAGAAGCCTCTGTTGAGAGG - Intronic
1158418023 18:57267011-57267033 CTTGACAAACATCTATTGAAGGG + Intergenic
1158582456 18:58696015-58696037 CCTGACAGGCATCTGTTATAAGG + Intronic
1159931010 18:74313188-74313210 CCTAACAAGTATTTATTGAATGG - Intergenic
1163863283 19:19753591-19753613 GCTGACAAGAACCTGCTGAAAGG + Intergenic
1164568069 19:29343827-29343849 CCTTTCAAGCATCTCTTGAAGGG - Intergenic
1166126855 19:40720068-40720090 CCTGGCCCCCATCTGTTGAATGG - Intronic
1166830546 19:45637054-45637076 CTTGATAAGCATCTGATGAGAGG - Intronic
926345016 2:11936938-11936960 CTTGACACACATCTGTAGAAGGG - Intergenic
929239193 2:39636305-39636327 CTTGGCAATCATCTGGTGAATGG + Intergenic
929828808 2:45331179-45331201 CCTGAAGAGCATGTGTTAAAGGG + Intergenic
930030379 2:47055038-47055060 TCTACCAAGCACCTGTTGAATGG + Intronic
930494195 2:52118367-52118389 CTTGAAAAGCATCAGTTGGATGG - Intergenic
930870775 2:56168678-56168700 CCAGACAAGCATCTGATTTAAGG - Intergenic
931257275 2:60584613-60584635 ACTGACAAGCAGCTGTTTGAAGG - Intergenic
936455948 2:112674437-112674459 CCTGGCAAGCAAATGTTGGAAGG + Intergenic
940111980 2:150165031-150165053 CCTTAAAAGCATCTCTTAAAAGG - Intergenic
941367466 2:164624678-164624700 GCTGACAAGAATCTGTTTCATGG - Intergenic
1174233991 20:49072648-49072670 GCTGACAAGTATCTGTGAAAAGG + Exonic
1177907846 21:26993768-26993790 CCTGAAAAGAGTCTGTAGAAAGG + Intergenic
1178730330 21:35096176-35096198 CTTGACATGCTTATGTTGAAGGG - Intronic
1180151238 21:45949129-45949151 CCTGACAAGCATCAGCCCAACGG - Intergenic
1180643678 22:17319795-17319817 CCTGAGGAGCAGCTGTTGATTGG + Intergenic
1184276161 22:43410977-43410999 CCCTACAAGCATTTGTTGAGGGG + Intergenic
950702742 3:14761462-14761484 CCCGGCAAACATCTGTTGACAGG - Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954622821 3:52005509-52005531 GCTGACAAGCAGCTGCTGAGCGG + Intergenic
957476136 3:80726700-80726722 CCAGCACAGCATCTGTTGAAAGG + Intergenic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
961951827 3:130757530-130757552 CTTGACATGCATCAATTGAAAGG - Intergenic
967511469 3:190318465-190318487 CCTAGCTTGCATCTGTTGAATGG + Intronic
973233240 4:47866647-47866669 CCTGACCACTATCTTTTGAAAGG + Intronic
981057415 4:140378152-140378174 CCTGACTAGGAGCTGATGAATGG + Intronic
982563899 4:156965276-156965298 CCCGATGAGTATCTGTTGAAAGG - Intronic
984540633 4:181033036-181033058 CCTGAAAAGCATTTATTTAAAGG - Intergenic
984929732 4:184836209-184836231 CCTGACAAGCATCTTAAAAATGG - Intergenic
987209251 5:15662173-15662195 CCTCACCAGCATCTGTTAATTGG + Intronic
988797784 5:34667827-34667849 CCTGACAAACATTTGTTACACGG - Intronic
998499775 5:142622160-142622182 TTTGATAAACATCTGTTGAATGG + Intronic
998520877 5:142799377-142799399 CTTGACAAGCATTTGTAGAATGG - Intronic
999276954 5:150337900-150337922 CCTGGGAAGCCTCTGTTGATGGG - Intronic
999861623 5:155653747-155653769 CCTCACCAGCATCTGTTGTGTGG + Intergenic
1001020009 5:168174801-168174823 GATGACAAGCTTCTGTGGAAAGG - Intronic
1004256310 6:14067952-14067974 TCTGACAAGCATCTGCTGGTTGG - Intergenic
1005018252 6:21393947-21393969 TCTGACAAGCATCAGATCAAAGG - Intergenic
1006600335 6:35221182-35221204 GCTGAGGAACATCTGTTGAAGGG + Intronic
1007906513 6:45466725-45466747 CCTAACAAAAATCTGTTTAATGG - Intronic
1009331918 6:62433411-62433433 TCTGACAAGCAAATGCTGAAAGG + Intergenic
1013705562 6:112829862-112829884 ACTGACAAGCAGCAGTGGAAAGG - Intergenic
1014495475 6:122116544-122116566 TTTTACAATCATCTGTTGAAGGG + Intergenic
1015088140 6:129321065-129321087 CCTGAGAAGCTTATGTTAAAGGG - Intronic
1018201968 6:161403514-161403536 TCTCACAAGCATTTGTTGAGAGG + Intronic
1019568827 7:1698682-1698704 GCTGACAAGCTTCTCTTGCATGG - Intronic
1020775042 7:12442641-12442663 CCTGACAAGGATTAGTTGGAAGG + Intergenic
1021035414 7:15792338-15792360 GCTGACAAGGATATGGTGAAAGG + Intergenic
1021321029 7:19211792-19211814 ACTGACAAGCCTCTGTTGCAGGG - Intergenic
1022458413 7:30579718-30579740 CCTCACAAGCATGTCATGAATGG + Intergenic
1022733447 7:33053953-33053975 CCTGACAAACATGATTTGAAAGG + Intronic
1028440195 7:90850764-90850786 CCTGTTAAGCAGCTGTTGAGAGG + Intronic
1032374636 7:131399367-131399389 CATGACAAGCTGGTGTTGAAGGG + Exonic
1032605785 7:133350402-133350424 CCTGTACAGCATTTGTTGAAAGG + Intronic
1039557953 8:38490249-38490271 CCAGCCACTCATCTGTTGAAAGG + Intergenic
1041168739 8:55118668-55118690 TTTGAGAAGCATCTTTTGAACGG - Intronic
1043399418 8:79869057-79869079 CCTGCCTAGCATTTGGTGAAGGG - Intergenic
1044373644 8:91444388-91444410 ACTGACAAGCATCTCTTCAGAGG - Intergenic
1045482621 8:102604339-102604361 CTTGACAAACATTTGTTGAGTGG - Intergenic
1045542573 8:103100727-103100749 CATGACAAGCATCTCTAAAAAGG - Intergenic
1046820579 8:118630227-118630249 CCTGTCCATCATCTGCTGAAAGG + Intergenic
1050463914 9:5900724-5900746 CCTGGAAAACATCTTTTGAAAGG + Intronic
1055975659 9:81952164-81952186 CCTGAAATGCATCTATTGAGTGG + Intergenic
1057023073 9:91715624-91715646 CCCAAGAAGCATTTGTTGAATGG + Intronic
1057144687 9:92749835-92749857 CCTGACTACAAGCTGTTGAATGG - Intronic
1057392579 9:94652063-94652085 CCTGGCAAGCATCCTTTCAATGG - Intergenic
1057714493 9:97480213-97480235 CTATACAAGCATCTGTAGAATGG - Intronic
1062048321 9:134434558-134434580 CTTCACAAGCATGTGTAGAATGG + Intronic
1062067999 9:134539211-134539233 CCTTGCAAGAATCTGTGGAATGG + Intergenic
1185796325 X:2968148-2968170 CCTGACATGCAGCTGTGTAAGGG + Intronic
1186193171 X:7085968-7085990 GCAGACAAGCCTCTGTGGAAGGG + Intronic
1187495959 X:19796034-19796056 CCTGACAAGCATCTGTTGAATGG + Intronic
1188335676 X:28929510-28929532 TCTGAGAAACATGTGTTGAAAGG + Intronic
1189907494 X:45776680-45776702 CCTGACCAGCATCTATCGCAAGG + Intergenic
1193559378 X:82998902-82998924 CCCAACCAGCATCTGATGAAGGG - Intergenic
1193969336 X:88032489-88032511 CCTCACCAGCATCTGTTGTAAGG - Intergenic
1195747257 X:108131270-108131292 CCCAACCAGCATCTGATGAAGGG - Exonic
1196010315 X:110880041-110880063 CCTCACCAGCATCTGTTGATTGG + Intergenic
1197252005 X:124226469-124226491 CCTGACAAGCATCAATTTAAGGG - Intronic
1197700475 X:129595849-129595871 CTTGACAAGTATTTGTTGAGTGG + Intergenic
1201252431 Y:12072951-12072973 TTTGGTAAGCATCTGTTGAATGG - Intergenic
1201565098 Y:15357418-15357440 CTAGACAAGCCTCTGTGGAAGGG + Intergenic