ID: 1187499996

View in Genome Browser
Species Human (GRCh38)
Location X:19831826-19831848
Sequence ATGTGTCCCCAGATGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187499996_1187499999 -4 Left 1187499996 X:19831826-19831848 CCCAATTCCATCTGGGGACACAT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1187499999 X:19831845-19831867 ACATTATTCTTACACTACATAGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187499996 Original CRISPR ATGTGTCCCCAGATGGAATT GGG (reversed) Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
905787729 1:40771276-40771298 TTCTGCCCTCAGATGGAATTAGG + Intronic
906695319 1:47819545-47819567 ATTTGGCGGCAGATGGAATTTGG + Intronic
907421115 1:54348110-54348132 CTCTGTCCCCAGATGGATATGGG - Intronic
907554913 1:55335123-55335145 ATGTGCCCCCAGAAGTAGTTTGG - Intergenic
908159208 1:61389910-61389932 ATGGGTCCCCAGATAGTAATAGG - Intronic
908549247 1:65192812-65192834 ATGTCTCCCCTGTTGGATTTTGG - Intronic
909626471 1:77721891-77721913 ATGTGTCCCTAGCTGGTTTTGGG - Exonic
909747577 1:79117079-79117101 ATGTGTGTCCAGGTGGAAATAGG + Intergenic
911335784 1:96578497-96578519 CAGTGCCACCAGATGGAATTTGG - Intergenic
912774756 1:112498684-112498706 ATGAGGCCTCAGATGGAAATGGG - Intronic
918745038 1:188187895-188187917 ATGTGTGTCCAGATGGACTCAGG + Intergenic
921153225 1:212418114-212418136 ATGTGACCTTAGATGGAAATAGG + Intergenic
921494183 1:215817019-215817041 ATGTGTCCACAGATAGATTCAGG + Exonic
921558705 1:216630510-216630532 ATTTGTTCCCAGCTGAAATTTGG - Intronic
922482477 1:225948768-225948790 ATGTGTCCCCAGGTGAAATCAGG - Intergenic
923258109 1:232239495-232239517 ATATGTCCCCAAATAGAAATAGG + Intergenic
1063192825 10:3713810-3713832 ATGTGTCTTCAGATTGAATAAGG + Intergenic
1063670675 10:8097175-8097197 ATGTGTCCCCAGAAGTATGTTGG + Intergenic
1063981133 10:11452757-11452779 AAGTGCCCCCAGATGAAATATGG - Intergenic
1064445137 10:15386351-15386373 AGGTGTCCCCAGATAGCTTTTGG + Intergenic
1065751220 10:28889693-28889715 ATTTGTCCTCAGTTGTAATTAGG + Intergenic
1067465495 10:46495221-46495243 ATGGGTCTCAAGATGGACTTGGG + Intergenic
1067621692 10:47889380-47889402 ATGGGTCTCAAGATGGACTTGGG - Intergenic
1067994632 10:51257952-51257974 ATATGTCCCCTATTGGAATTAGG + Intronic
1070056634 10:72941324-72941346 ACTTTTCCCCAGATGGACTTGGG - Exonic
1072391110 10:94987924-94987946 ATGTGTCAACATATGAAATTGGG + Intronic
1073809476 10:107136907-107136929 ATTTGTTCCCAGATAGAGTTAGG - Intronic
1077232909 11:1466336-1466358 AAGTGTACCCAGCTGGATTTTGG - Intergenic
1077584924 11:3443916-3443938 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1079122130 11:17693715-17693737 ATGTGGCCACGAATGGAATTAGG + Intergenic
1080964157 11:37195037-37195059 ATGTCTGCCCTGATGGATTTTGG - Intergenic
1081043599 11:38242660-38242682 ATGTCTCCCCTGCTGGATTTTGG - Intergenic
1084241824 11:67826483-67826505 ATGTGTCCCCATAAGGCACTGGG + Intergenic
1084830515 11:71765370-71765392 ATGTGTCCCCAAAAGGCACTGGG - Intergenic
1085771847 11:79332522-79332544 ATTAGCCCCCAGATGGATTTCGG - Intronic
1088037198 11:105332335-105332357 ATGTGTTCTCAGTTGGAATCTGG + Intergenic
1088710777 11:112506563-112506585 ATGTGACCCCATTTGGAAATAGG - Intergenic
1088816789 11:113426736-113426758 ATGTCACCCCACATGGAATTAGG - Intronic
1090578277 11:128132478-128132500 ATGTGTGCCCAGGTGAAATCAGG - Intergenic
1096524958 12:52205048-52205070 ATGTGTCTCCAGCTGGACTTGGG - Intergenic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1096802392 12:54119798-54119820 AATTGACCCCAGATGGAATAGGG + Intergenic
1097354343 12:58584826-58584848 ATGTGTTTCCAGAAGGATTTAGG + Intronic
1098325970 12:69301607-69301629 ATGTGACCTCATCTGGAATTAGG - Intergenic
1100732981 12:97494155-97494177 ATCTGTCCCCAGGTAGCATTTGG + Intergenic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG + Intronic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1113056382 13:106272450-106272472 TTGAGTCCCCAGATGGAAACAGG - Intergenic
1113522281 13:110949461-110949483 ATGTGTCCCCATATGTAAGAGGG + Intergenic
1113581218 13:111430882-111430904 GTGTCTCCCCAGATGGAACAAGG + Intergenic
1117495986 14:56304662-56304684 ATGTGGCCCCACATGGAGATGGG + Intergenic
1117999052 14:61505981-61506003 AAGTGTCCCCAGGTTGCATTTGG + Intronic
1118677103 14:68198896-68198918 AACTGTCCCCAAATGGAATAGGG - Intronic
1118896731 14:69951616-69951638 AACTTTCCCGAGATGGAATTTGG + Intronic
1120290006 14:82556414-82556436 ATGTCTCCCAAGCTGGAATTAGG + Intergenic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1122351920 14:101101075-101101097 ATGTGACCTCATTTGGAATTGGG + Intergenic
1122884909 14:104706617-104706639 TTGTGTCCCCAGGTGGCATCTGG + Intronic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1138962967 16:62049724-62049746 ATGTCTCCCCAAATGAAATTGGG - Intergenic
1138973361 16:62172933-62172955 ATGTGTCACCATATGGTACTAGG + Intergenic
1139303866 16:65967014-65967036 AGATGTCCCCAGTGGGAATTTGG - Intergenic
1145393273 17:22473516-22473538 ATGTGTTCCTAAATGGAATGGGG - Intergenic
1146625877 17:34435097-34435119 ATGTGTCCCCAGGTTGAATGTGG + Intergenic
1150219743 17:63489304-63489326 ATGTGGCACCAGATGCAAGTGGG - Intronic
1152195107 17:78913250-78913272 ATGTTTCCCCAGATAGACTCAGG - Intronic
1155935322 18:31747236-31747258 AGGTGGCTCCAAATGGAATTAGG - Intergenic
1156517826 18:37696059-37696081 ATGTGTCCCAAGAAGAAACTGGG - Intergenic
1157967060 18:52220186-52220208 AAGTCTGCCCAGATTGAATTTGG - Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1161100054 19:2416978-2417000 TTTTGCCCCCAGATGGAATGGGG - Intronic
1164325764 19:24189945-24189967 ATATGTCACAAGATGCAATTTGG + Intergenic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1166247509 19:41539543-41539565 ATCTGTCCCTCGATTGAATTAGG - Intergenic
1166643295 19:44512716-44512738 CTGTGTTCCCATCTGGAATTTGG - Intronic
925867627 2:8243037-8243059 AGGTGACCCCAGATGAACTTGGG - Intergenic
925888211 2:8411727-8411749 ACGAGTCCCCAGATGGTATTGGG - Intergenic
927657252 2:24959665-24959687 ATCTGTTTCCAGATGGAGTTAGG - Intronic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
934051117 2:88211845-88211867 CTGTCTCTCCAGATGCAATTGGG - Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936346706 2:111680933-111680955 ATGTGTCCTCATTTGGAAATAGG + Intergenic
936732995 2:115406260-115406282 ATGAGACCTCAGATGGAAATAGG - Intronic
937697496 2:124824252-124824274 ATGACTCCCCAGATGGCTTTGGG - Intronic
942869863 2:180721672-180721694 ATGTGTCTGTAGATGGAACTGGG + Intergenic
943374249 2:187055317-187055339 CTTTGTCCCCAGAGGGGATTTGG + Intergenic
943572986 2:189596095-189596117 ATGTGACCCCATTTGGAAATAGG + Intergenic
943812801 2:192210563-192210585 ATTTGGCCTCAGATGGAAATGGG + Intergenic
943856530 2:192800818-192800840 ATTTCTCCCCAGTTGGATTTTGG - Intergenic
948183452 2:236001032-236001054 ATGTGGCCTCATATGGAACTAGG + Intronic
948266771 2:236640836-236640858 CTGTGGCCCCAGCTGGAATCAGG + Intergenic
1168824041 20:797044-797066 ATGGGTCCCCTGATGTAGTTGGG - Intergenic
1170317960 20:15062955-15062977 ATCTGTCTGCAGATGGGATTTGG + Intronic
1171355917 20:24545286-24545308 AGGTGTCACCAGAGGGCATTGGG - Intronic
1173072493 20:39782497-39782519 ATGTGTTCCCTTATGAAATTGGG - Intergenic
1173350980 20:42245306-42245328 ATGTGGAACCATATGGAATTAGG - Intronic
1174024943 20:47566269-47566291 GTGAGTCCCAAGCTGGAATTTGG + Intronic
1179931316 21:44572722-44572744 ATGTGACCCTATATGGAAATAGG + Intronic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960631767 3:119739462-119739484 ATGGGTCACCAGAAGGAAATGGG - Intronic
961296169 3:125886335-125886357 ATGTGTCCCCAAAAGGCACTGGG - Intergenic
961602751 3:128073612-128073634 ATGTGGCCCTAGAAGGGATTGGG - Intronic
961889632 3:130119841-130119863 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
966078129 3:175964120-175964142 ATGTGCCACCTGATGGAAGTTGG + Intergenic
967899612 3:194436033-194436055 ATGTGTCCTTAGTAGGAATTAGG + Intronic
969000121 4:3973759-3973781 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
969753901 4:9134848-9134870 ATGTGTCCCCAAAAGGCACTGGG - Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
975385327 4:73751567-73751589 AGGTGTTTCCAGATGGAAGTGGG + Intergenic
978239793 4:106501891-106501913 AAGTCTCCCCAGATGGAAACAGG + Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
983891818 4:173037511-173037533 ATGTGTTCCAATATGGGATTTGG + Intronic
984820982 4:183882181-183882203 ATGACTCCCAAAATGGAATTTGG + Intronic
985317168 4:188670469-188670491 ATGTGGCCCCAGATGTGATATGG - Intergenic
991413912 5:66371730-66371752 AAGTGTCCCCAGATGAAGTTAGG - Intergenic
991536183 5:67671607-67671629 ATGTGTCCTCACATGGTATAAGG - Intergenic
991618291 5:68518810-68518832 ATGTGTCTCTGGCTGGAATTAGG - Intergenic
993816825 5:92558846-92558868 ATGTGTCCCCATATTGAAAGAGG + Intergenic
994088736 5:95789139-95789161 ATGTGTCCTCAGGTGACATTTGG + Intronic
1008151005 6:47950926-47950948 ATGTGTCAATTGATGGAATTTGG + Intronic
1010429278 6:75760154-75760176 ATGTGTCCTCAAAAGGACTTGGG - Intronic
1010548557 6:77190462-77190484 ATGTGACCCCATTTGGAAATAGG + Intergenic
1010932315 6:81817919-81817941 ATTTGCCCCCAGATAGAATGTGG - Intergenic
1012868754 6:104648287-104648309 AAGTGTGTCCAGATGGAATGTGG + Intergenic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1016813529 6:148283044-148283066 GGGAGTCCCCAGATGAAATTGGG - Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1018122726 6:160652566-160652588 ATGTGACTCCAGATGGAAATTGG + Intronic
1018830120 6:167435615-167435637 ATGTGTCCGCAGAGAGAATCCGG + Intergenic
1019804005 7:3109291-3109313 AAGTGTTCCAAGATGAAATTTGG - Intergenic
1021882132 7:25105246-25105268 ATGGGTCCCCAGAGAGAATGTGG - Intergenic
1022725146 7:32974518-32974540 ATGTGCCCACAGATGTAATGGGG - Intronic
1023673645 7:42606539-42606561 CTGTGTCCCTTGATGGGATTCGG - Intergenic
1024873089 7:53988864-53988886 AATTGTCCCCAGATGGTATTTGG - Intergenic
1025048455 7:55713327-55713349 ATGTGCCCACAGATGTAATGGGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028716078 7:93970710-93970732 ATGTGTTCACAAATGTAATTGGG + Intronic
1030667626 7:112297905-112297927 ATGTGTCTGCAGATGGACTCAGG + Intronic
1030926463 7:115461483-115461505 ATGTGTCCCCAGATCTCCTTGGG + Intergenic
1031100542 7:117474819-117474841 AACTGTGTCCAGATGGAATTTGG - Intronic
1031987838 7:128174830-128174852 ATGAAGCCCCAAATGGAATTTGG - Intergenic
1033284229 7:140026787-140026809 ACCTGTCCCCAGATGGGGTTGGG - Intronic
1033526467 7:142219267-142219289 ATGAGTGCCCTGATGGTATTTGG + Intronic
1034512521 7:151547930-151547952 AAGGGTCCCCACATTGAATTTGG + Intergenic
1036852431 8:12212952-12212974 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
1036873799 8:12455475-12455497 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
1037055693 8:14438570-14438592 AAGTGTTCCTAGAGGGAATTAGG + Intronic
1037959082 8:23083118-23083140 ATGGGACGCCAGATGGAAGTGGG - Intergenic
1040049166 8:42995037-42995059 CTGTGTCCCCATATTGAATGTGG + Intronic
1048911472 8:139139460-139139482 ATGTGTCCCCAGAGGGACCCTGG - Intergenic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1050932609 9:11349231-11349253 ATGTTTCCCCAAAAGGAATGTGG + Intergenic
1051732377 9:20158453-20158475 ATGTGTCCTCAAATGGCATAAGG - Intergenic
1052861975 9:33442960-33442982 ATCTGTCACCAGATGCAATCTGG - Exonic
1053590220 9:39506288-39506310 ATGTTTTCCAAGGTGGAATTTGG + Intergenic
1053785583 9:41650452-41650474 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1053847978 9:42260457-42260479 ATGTTTTCCAAGGTGGAATTTGG + Intergenic
1054174302 9:61864418-61864440 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054449160 9:65393463-65393485 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054576081 9:66859001-66859023 ATGTTTTCCAAGGTGGAATTTGG - Intronic
1054663236 9:67716373-67716395 CTCTGTACCCAGAGGGAATTAGG - Intergenic
1056486953 9:87068511-87068533 ATGTGGCCACAGTTAGAATTTGG - Intergenic
1057462010 9:95271522-95271544 AGGTGTCCCCAGAGGGAATGTGG + Intronic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1188635311 X:32422703-32422725 CAGTGTCCCTAGATGGAATGAGG - Intronic
1196974854 X:121148130-121148152 ATGTGTCCTCACATGGAAGAAGG - Intergenic
1198885736 X:141334109-141334131 ATGTGGCTTCAGATGGAAGTGGG + Intergenic
1199275485 X:145937233-145937255 ATGAGTTCCCAGATGCCATTAGG - Intergenic
1201724286 Y:17136376-17136398 ATGGGTCCCAAGATGGTAGTAGG + Intergenic