ID: 1187500347

View in Genome Browser
Species Human (GRCh38)
Location X:19833606-19833628
Sequence CTGTGGAAAGGCGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5447
Summary {0: 1, 1: 1, 2: 3, 3: 287, 4: 5155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187500347_1187500353 -4 Left 1187500347 X:19833606-19833628 CCATCCACCTCGCCTTTCCACAG 0: 1
1: 1
2: 3
3: 287
4: 5155
Right 1187500353 X:19833625-19833647 ACAGTCCTCCTTCCTTCCCAGGG 0: 3
1: 1
2: 7
3: 36
4: 371
1187500347_1187500352 -5 Left 1187500347 X:19833606-19833628 CCATCCACCTCGCCTTTCCACAG 0: 1
1: 1
2: 3
3: 287
4: 5155
Right 1187500352 X:19833624-19833646 CACAGTCCTCCTTCCTTCCCAGG 0: 3
1: 1
2: 10
3: 54
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187500347 Original CRISPR CTGTGGAAAGGCGAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr