ID: 1187505636

View in Genome Browser
Species Human (GRCh38)
Location X:19876056-19876078
Sequence TTCAAAACCCAGATGGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187505630_1187505636 21 Left 1187505630 X:19876012-19876034 CCTTACTATATATACAACATGAA 0: 1
1: 0
2: 3
3: 16
4: 311
Right 1187505636 X:19876056-19876078 TTCAAAACCCAGATGGGTTAAGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187505636 Original CRISPR TTCAAAACCCAGATGGGTTA AGG Intronic
900968424 1:5975691-5975713 TTCACAATTCAGATGTGTTAGGG - Intronic
902700128 1:18166773-18166795 TTCAAAGCCCAAATGGGGAAGGG + Intronic
904617132 1:31755998-31756020 TTCACAACCGAGATGAGATATGG - Exonic
904817759 1:33218764-33218786 CTGAGAAACCAGATGGGTTAAGG - Intergenic
905168044 1:36094694-36094716 TTCAAAACACAGATTGCTTCAGG + Intergenic
906132692 1:43470315-43470337 TGCAAAAGCCAGATGGGGCATGG - Intergenic
908033997 1:60032345-60032367 TTCAAAGTCCAGAAGAGTTATGG - Intronic
910432138 1:87169402-87169424 TTCAAAGTCCAGATTAGTTATGG + Intergenic
911314500 1:96339737-96339759 TTCACAAACCAAATGGGTCATGG + Intergenic
911674410 1:100642960-100642982 TTCATAACACCCATGGGTTAAGG + Intergenic
911733595 1:101314050-101314072 TTCAAAACCCAGCAGGATTTCGG + Intergenic
913222545 1:116670612-116670634 ATCACCACCCAGATGTGTTATGG + Intergenic
916439272 1:164806961-164806983 TTCAAAACCAAGATGGGGCTGGG + Intronic
918616912 1:186554954-186554976 TTTAAAACCCAAGTGGGTTTGGG - Intergenic
923282446 1:232457076-232457098 TTCAAAACACAGGTGGCTTTAGG + Intronic
924041609 1:239989336-239989358 CTTAAAAGCCAGATGGGTTATGG + Intergenic
924322278 1:242862164-242862186 TTAAATAAACAGATGGGTTATGG + Intergenic
1064666311 10:17655766-17655788 TTTTAAACACAGATGGGTTGGGG - Intronic
1068632734 10:59314404-59314426 ATCAAAGCCCAGAGAGGTTAGGG + Intronic
1068811756 10:61263543-61263565 TTCAAAGCCAAAAAGGGTTATGG + Intergenic
1070323068 10:75369324-75369346 GTCATAACCCCCATGGGTTAAGG + Intergenic
1072243196 10:93517016-93517038 TTCAAAACTCAGCTGAGTTATGG - Exonic
1073615732 10:104992834-104992856 TTAAAAACCTAGATTAGTTAGGG - Intronic
1074443377 10:113497975-113497997 TTCAGAACCCTGTTGGGGTAGGG - Intergenic
1080533843 11:33202783-33202805 TTCAAAAGCCAGATGAGTCCTGG + Intergenic
1089115540 11:116092239-116092261 TGCAAAACCCAGATAGATTATGG - Intergenic
1091096366 11:132825970-132825992 TACAAAACCCTGAGTGGTTAGGG - Intronic
1100872511 12:98924966-98924988 TTCAAAGTCCAGACGGGATAAGG + Intronic
1102470494 12:113157420-113157442 TTCAAAACCCAGAACGGTTTAGG + Exonic
1104626324 12:130358642-130358664 TTCAAAACACTGATGGGATTGGG - Intronic
1105392971 13:19998979-19999001 TTCAAAATGAAGATAGGTTATGG + Intronic
1106789489 13:33140154-33140176 TTCAAAACCCAGAGGCGAGATGG - Intronic
1107746708 13:43517953-43517975 TTCATAAGCCACATGGTTTATGG + Intronic
1108157183 13:47597421-47597443 GGCAAAACCCACATGGATTATGG - Intergenic
1108734894 13:53272723-53272745 ATCAAAACCCAGATCGGTAGTGG + Intergenic
1109999068 13:70170301-70170323 TTCAAAACCTTAATGGTTTAAGG + Intergenic
1116374424 14:44180537-44180559 ATGAAAACCTAGATGGATTAAGG + Intergenic
1116946814 14:50843181-50843203 TTCAAAAGCCAAATGAATTAGGG + Intergenic
1117135120 14:52728061-52728083 TTGATAACCCAGATGGATTGTGG + Exonic
1117610138 14:57474732-57474754 TTAAAAACCTAAATGGGTTTCGG + Intronic
1120061911 14:79993317-79993339 TAGAAAATCCAGATGGCTTAAGG - Intergenic
1120475085 14:84976942-84976964 CTTAAAACCCAGAAAGGTTAAGG - Intergenic
1123771848 15:23537020-23537042 TACAAATCCCAGAGAGGTTAGGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1128651345 15:69416047-69416069 TTAAAGACCCAGTTGGGGTAAGG + Exonic
1129953804 15:79615062-79615084 ACAAAAAGCCAGATGGGTTAAGG + Intergenic
1131588712 15:93724478-93724500 TTCAAAACTCAGATGGTCTGAGG - Intergenic
1132227481 15:100153732-100153754 TTCTAAAGGCAGATGGTTTAAGG + Intronic
1137403427 16:48171526-48171548 AACAAAACCCAAATGGCTTAAGG - Intronic
1139583085 16:67884752-67884774 TCCAACACCCAGATGGGAAAAGG - Intergenic
1156621244 18:38854656-38854678 TTCAAAACTCAAATAAGTTATGG - Intergenic
1157334068 18:46724456-46724478 TTCAAAACACAGAAGGGCTCCGG + Intronic
1158652123 18:59297573-59297595 TTAAAAATCCAGATGGGGTTGGG - Intronic
1159610620 18:70521225-70521247 TTCAAAAACCAGGTGAGATATGG - Intergenic
1164056981 19:21630078-21630100 TTCCCAACCCAGAAGGGTTGGGG - Intergenic
1165910799 19:39225587-39225609 TTTAAAAGCCAGTTGAGTTAGGG - Intergenic
1166238926 19:41476337-41476359 TTCAAAATCCAGAAGGATGATGG - Intergenic
1166241184 19:41495316-41495338 TTCAAAATCCAGAAGGATGATGG - Intergenic
1167499989 19:49840640-49840662 TTGAAAACTCAGATGGCTTCAGG + Intergenic
925563796 2:5227285-5227307 TTCAAAACCCAAATAGGTGTGGG - Intergenic
928395245 2:30938731-30938753 ATGAAAACCAAGATGGGGTAGGG + Intronic
936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG + Intergenic
937064960 2:119011012-119011034 TTCAAAACAGTGATGAGTTAGGG + Intergenic
937087276 2:119179738-119179760 CTCACAACACAGGTGGGTTAGGG + Intergenic
937536681 2:122897248-122897270 TGCAAAACACAGAAGGGTCATGG + Intergenic
938942838 2:136184004-136184026 CTTAAAACCCAGATGGTTGATGG - Intergenic
939284641 2:140113407-140113429 TTCAAAACCTATATGAGTTCAGG - Intergenic
941452681 2:165678472-165678494 TTCAAAATAAAAATGGGTTATGG - Intronic
942524338 2:176837722-176837744 TTCATAGCCAAGATGGGTAAAGG + Intergenic
944150962 2:196558238-196558260 TTTCAAACTCAGATGGGCTATGG + Intronic
944176598 2:196836219-196836241 TTCAAAACACAGATTGTTTTTGG + Exonic
944650842 2:201828789-201828811 TGCAAAACCCAGAAAGATTAGGG - Intronic
946570239 2:221016626-221016648 TTCAAAACCCAGTTGTTTAAGGG - Intergenic
948311363 2:236989425-236989447 TTCCAGACCCTGATGGATTAGGG + Intergenic
1169613343 20:7409210-7409232 TCCAAAACCCATATGATTTATGG + Intergenic
1170601425 20:17844236-17844258 TTCAAGACCCAGCTGAGTTAAGG - Intergenic
1170694562 20:18646791-18646813 TTCAAAACCATGTTGGGTTGTGG - Intronic
1173390158 20:42624609-42624631 TTCAGAACTGAGTTGGGTTATGG - Intronic
1173713644 20:45181905-45181927 TCCAAAACCCAGCAGGGTTCTGG + Intergenic
1174034159 20:47656909-47656931 TTTAAATCCCTGTTGGGTTAAGG + Exonic
1176267426 20:64217541-64217563 AACAAAACCCAGATCCGTTACGG + Intronic
1177718547 21:24873250-24873272 TTCAAAAACCAGATGGTTCTGGG + Intergenic
1179526272 21:41977897-41977919 TTCCAAACAGAGATGGGTGAGGG + Intergenic
1182280257 22:29214331-29214353 TTCAAAGCCCAGATGTGACATGG - Intronic
1182371892 22:29817054-29817076 TTCAAAAACCAGATGGGGCTGGG + Intronic
1182684784 22:32113637-32113659 TTCAAAAGCTGGCTGGGTTAAGG + Intergenic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
1184919675 22:47596930-47596952 TTCAAAACCCACATCGGTAGTGG + Intergenic
950112305 3:10427102-10427124 TTCAAAACAGATGTGGGTTAAGG + Intronic
950947011 3:16959726-16959748 TTCTAAACACAGATGGGATATGG - Intronic
952922600 3:38296330-38296352 TTCCCAACCCAGAAGGGTTGGGG + Intronic
958114900 3:89203007-89203029 GTGAAAAACCAGATGGGATAAGG + Intronic
959605115 3:108234173-108234195 TTCAAAAACCAGATGGCTCCTGG - Intergenic
961375281 3:126461344-126461366 TTTAAGGCTCAGATGGGTTAAGG + Intronic
963314583 3:143745658-143745680 TTCAAAACCTATATGGCTCAAGG - Intronic
965208909 3:165759197-165759219 TTCTGAACCCAGTTGGGTCAGGG - Intergenic
965492674 3:169358906-169358928 TTCATTACCCACATGGGTAAGGG - Intronic
972126622 4:35774699-35774721 TTGAAAAGTCAGATGAGTTAAGG + Intergenic
974705433 4:65509421-65509443 TTCAAAACCCGAATGGGTCTTGG + Intronic
974705715 4:65512939-65512961 TTTAAAAGCCAGATGCGTGATGG + Intronic
975063300 4:70031488-70031510 TTCAAAAACAAAATTGGTTATGG + Intronic
975981737 4:80168986-80169008 CTCCAAATACAGATGGGTTAGGG - Intergenic
976087642 4:81422512-81422534 TTCAAAATCCAGATGTTTCAGGG + Intergenic
977123831 4:93139208-93139230 TCCTAAACCCAGAGGGGTGAGGG + Intronic
977380202 4:96263434-96263456 TGCAAAACCCATATGGCTAAAGG - Intergenic
977872612 4:102110705-102110727 TTCAACACCCAGTTTGTTTAGGG - Intergenic
983758496 4:171373802-171373824 ATTAAAACCCATATAGGTTAAGG + Intergenic
987714249 5:21546306-21546328 TACAAAAGTCAGATGGGTTCTGG - Intergenic
993409835 5:87559676-87559698 ATCAAAACCCAGATGGAATGAGG - Intergenic
1002384740 5:178857949-178857971 GTCAAAAGCCATATGGTTTAGGG + Intergenic
1003468029 6:6400032-6400054 TGCAAAAACCAGATGGATCATGG + Intergenic
1003999619 6:11585159-11585181 TGCAAAACACAGATGGTGTAAGG - Intergenic
1009002477 6:57735773-57735795 TACAAAAGTCAGATGGGTTCTGG + Intergenic
1009936810 6:70244060-70244082 TTCAAAATTCAGAAGGTTTATGG - Intronic
1010471107 6:76229683-76229705 TTCAAAAGACAGATGGGTTTTGG - Intergenic
1011197224 6:84793979-84794001 TGCAAAAACCAGATGGATCATGG + Intergenic
1011960103 6:93078121-93078143 TCCAAAAATCAGATGGTTTAGGG + Intergenic
1013021861 6:106228848-106228870 TTCCCAACCCAGAAGGGTTGAGG - Intronic
1013268941 6:108527872-108527894 TTTAAAACACAGATGGGCTCTGG + Intergenic
1014404903 6:121039382-121039404 TTGAAAAACAAGATGGATTAAGG + Intergenic
1015083518 6:129258198-129258220 TTCAAAACCCCGTTGTGTTAAGG + Intronic
1016619399 6:146090745-146090767 GTCCAAACCCAGGTGGCTTAAGG + Intronic
1017293070 6:152763732-152763754 GTCAAAACCCAGATTTGCTAGGG + Intergenic
1019486795 7:1293121-1293143 ATCAAGACCCAGAGGGGCTAAGG - Intergenic
1019745226 7:2696144-2696166 TTCAAAACCGAGGTGGAGTAGGG - Intronic
1020529122 7:9307267-9307289 TTCAAAACCCAGTTGTGTGGTGG + Intergenic
1022266810 7:28764400-28764422 TCCAAAACCCAAATGGCTAATGG - Intronic
1023558028 7:41443598-41443620 TTCAAACCACATAGGGGTTAGGG + Intergenic
1029550200 7:101233285-101233307 TTGAAAACCCAGCTGGGCCATGG + Intronic
1030336921 7:108338028-108338050 TTCCCAACCCAGAAGGGTTGGGG - Intronic
1030763084 7:113375317-113375339 TTGCAAAGCCAGATGGGATAAGG + Intergenic
1033774673 7:144594764-144594786 TTCAAAATCCAGAAGGGGGATGG + Intronic
1039035557 8:33355544-33355566 TTCAAACCCAAGTTGGTTTATGG - Intergenic
1039280572 8:35979623-35979645 TTCAGAATCCCGATGGATTAGGG - Intergenic
1039730201 8:40266786-40266808 TGAAAAAACCACATGGGTTAGGG + Intergenic
1043686186 8:83089419-83089441 TGTAAAAACCAGATGGATTATGG + Intergenic
1045867834 8:106889430-106889452 TCCAAAACCCAGTTTGGTTCGGG + Intergenic
1046361568 8:113165377-113165399 TGCAAAATCCAGATTGTTTAGGG - Intronic
1048722550 8:137342866-137342888 ATCAAAGCCCAGATAGGTTAAGG - Intergenic
1049140940 8:140953522-140953544 TTCACATCCCAGGTGGGATAGGG + Intronic
1053002659 9:34585863-34585885 TTTGAAATGCAGATGGGTTAGGG - Intronic
1053206869 9:36193756-36193778 GGCAAAAACCAGAGGGGTTAGGG + Intronic
1054729076 9:68682445-68682467 TTCATAAACTAGATGGTTTAAGG + Intergenic
1055085124 9:72305947-72305969 TAGAAAACCCATATGGGTTTGGG + Intergenic
1056533471 9:87507767-87507789 TTCATAAGCCTGATGGGTTTTGG + Intronic
1057489785 9:95511536-95511558 TTCAAAACTCAGACCGCTTAAGG + Intronic
1057803010 9:98201412-98201434 GTCAAGACGCAGATGGGTGAAGG + Intronic
1057863935 9:98664326-98664348 TTCAAAAACCAGATGGATCCTGG + Intronic
1057914514 9:99045478-99045500 TCAGAAGCCCAGATGGGTTATGG - Intronic
1059584876 9:115595435-115595457 TTTAAAATCCAGATGGATTTAGG + Intergenic
1059737930 9:117120888-117120910 TTCAAAATTCAGATGGATTCAGG + Intronic
1186406058 X:9304168-9304190 TTCATAACTCACATGGGTTGTGG - Intergenic
1187505636 X:19876056-19876078 TTCAAAACCCAGATGGGTTAAGG + Intronic
1189734463 X:44055632-44055654 TTCAAAACCCTGATCTGTAACGG + Intergenic
1194424602 X:93721134-93721156 TGCAAAAGCCAGATGGATGATGG - Intergenic
1195236705 X:102906437-102906459 TTCATCACCCAGAGGGGTTGTGG - Intergenic
1195301635 X:103535827-103535849 TTCATCACCCAGAGGGGTTGTGG + Intergenic
1195584701 X:106551954-106551976 TTCCTAACCCAGAAGGGTTGGGG - Intergenic
1195604063 X:106782477-106782499 ATCAAAAGACAGATGAGTTATGG + Intronic
1197167369 X:123392520-123392542 TTCAAAGCCCATGTGGGTTGAGG + Intronic
1198091450 X:133334958-133334980 TTAAAATCCCAAATAGGTTAAGG - Intronic