ID: 1187507137

View in Genome Browser
Species Human (GRCh38)
Location X:19887230-19887252
Sequence GGGCTCCGCGGTTCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187507117_1187507137 10 Left 1187507117 X:19887197-19887219 CCCGTCCGGACCCTGCCCCCGGG 0: 1
1: 0
2: 2
3: 20
4: 266
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507115_1187507137 11 Left 1187507115 X:19887196-19887218 CCCCGTCCGGACCCTGCCCCCGG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507121_1187507137 5 Left 1187507121 X:19887202-19887224 CCGGACCCTGCCCCCGGGGCGCC 0: 1
1: 0
2: 2
3: 51
4: 492
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507128_1187507137 -7 Left 1187507128 X:19887214-19887236 CCCGGGGCGCCCTCCCGGGCTCC 0: 1
1: 0
2: 3
3: 52
4: 400
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507126_1187507137 -5 Left 1187507126 X:19887212-19887234 CCCCCGGGGCGCCCTCCCGGGCT 0: 1
1: 0
2: 3
3: 16
4: 260
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507123_1187507137 -1 Left 1187507123 X:19887208-19887230 CCTGCCCCCGGGGCGCCCTCCCG 0: 1
1: 0
2: 6
3: 61
4: 508
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507122_1187507137 0 Left 1187507122 X:19887207-19887229 CCCTGCCCCCGGGGCGCCCTCCC 0: 1
1: 0
2: 2
3: 45
4: 524
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507129_1187507137 -8 Left 1187507129 X:19887215-19887237 CCGGGGCGCCCTCCCGGGCTCCG 0: 1
1: 0
2: 2
3: 37
4: 339
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507110_1187507137 25 Left 1187507110 X:19887182-19887204 CCCACCGCGGTGTCCCCCGTCCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507127_1187507137 -6 Left 1187507127 X:19887213-19887235 CCCCGGGGCGCCCTCCCGGGCTC 0: 1
1: 0
2: 0
3: 25
4: 258
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507119_1187507137 9 Left 1187507119 X:19887198-19887220 CCGTCCGGACCCTGCCCCCGGGG 0: 1
1: 0
2: 3
3: 25
4: 283
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507113_1187507137 21 Left 1187507113 X:19887186-19887208 CCGCGGTGTCCCCCGTCCGGACC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507114_1187507137 12 Left 1187507114 X:19887195-19887217 CCCCCGTCCGGACCCTGCCCCCG 0: 1
1: 0
2: 3
3: 27
4: 327
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1187507111_1187507137 24 Left 1187507111 X:19887183-19887205 CCACCGCGGTGTCCCCCGTCCGG 0: 1
1: 0
2: 5
3: 7
4: 74
Right 1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187507137 Original CRISPR GGGCTCCGCGGTTCTGGGAC TGG Intronic
900519009 1:3096681-3096703 GGGCTCAGCAGCCCTGGGACGGG - Intronic
900576804 1:3386804-3386826 GGGCACCGCGGGGCTGGGCCAGG + Intronic
901195803 1:7439153-7439175 GGGGTCTGCGGTCCTGGGTCGGG + Intronic
902224412 1:14987708-14987730 GGGCTCTGCGGTCCTGGGTAAGG + Intronic
902732455 1:18378189-18378211 AGGCTCTGCTGTTCTGGAACGGG + Intronic
903748420 1:25603911-25603933 GGGCTCCTCAGTTCTCAGACGGG - Intergenic
903993366 1:27289286-27289308 GGGCTCCTCAGTTCTCAGACGGG + Intronic
904194530 1:28775273-28775295 TGGCTCCGGGTTTCCGGGACAGG + Intergenic
906717324 1:47979861-47979883 GGGTTCCCAGCTTCTGGGACAGG - Intronic
907140556 1:52181814-52181836 GGGCTCCTCGCTTCTCAGACGGG - Intronic
907140567 1:52181854-52181876 GGGCTCCTCGCTTCTCAGACGGG - Intronic
912209724 1:107544954-107544976 GGGCTTCTGGGGTCTGGGACTGG - Intergenic
915897878 1:159825476-159825498 GGGCTTCGCGGATCTGGGCAGGG - Intergenic
917304587 1:173613282-173613304 GGGCTCCTCGCTTCTCAGACGGG - Intronic
917304597 1:173613322-173613344 GGGCTCCTCGCTTCTCAGACGGG - Intronic
920171128 1:204073197-204073219 GGGCTCGCCGGTTCTGGGCCCGG - Intronic
922890342 1:229057356-229057378 TGACTCCCCTGTTCTGGGACTGG - Intergenic
1062847998 10:722657-722679 GGGCACCGTGGTCCTGGGCCAGG + Intergenic
1063130419 10:3172918-3172940 GGCCTCCACTGCTCTGGGACGGG + Intergenic
1066140517 10:32500311-32500333 GGGCTCCTCACTTCTCGGACGGG + Intronic
1067034144 10:42900468-42900490 GGGCTCCTCGCTTCTCAGACGGG - Intergenic
1075656128 10:124162380-124162402 GGGCACCGGGGATCTGGGAGCGG + Intergenic
1076481333 10:130786917-130786939 AGGCTCTGGGGTTCTGGGACAGG - Intergenic
1076481472 10:130787853-130787875 AGGCTCTGGGGTTCTGGGACAGG + Intergenic
1076899412 10:133330001-133330023 GGGCCCCGCGGGGCTGGGAGAGG + Intronic
1078122399 11:8523486-8523508 GGGCTCCTCGCTTCTCAGACAGG - Intronic
1078563983 11:12398011-12398033 GGGCCCAGCTGTTCTGGGCCTGG - Intronic
1078743438 11:14090079-14090101 GGGCTCCACGGGAATGGGACCGG + Intronic
1081812576 11:45922204-45922226 GTGCTCCGCGGCTCTGGCGCAGG + Intronic
1083227751 11:61295301-61295323 GGGCTCCGCGCCTCTCGGAGAGG - Exonic
1083406115 11:62458412-62458434 GTGCACCACGGTTCTGAGACGGG + Intronic
1083618101 11:64036188-64036210 GGGGTCCGCGCGTCTGGGACAGG + Intronic
1083726281 11:64630277-64630299 GGGCTAAGCGGCTCTGGGGCGGG - Intronic
1083726288 11:64630298-64630320 GGGCTAAGCGGCTCTGGGGCGGG - Intronic
1084888224 11:72224112-72224134 GGGCTCTGCGGGGCTGGGAGGGG + Intronic
1088994651 11:114985916-114985938 GTGCTCAGCGGTGCTGGGCCAGG + Intergenic
1090152785 11:124403377-124403399 GGGCTCCTCACTTCTCGGACGGG + Intergenic
1098963622 12:76763965-76763987 GGGCCCCGCGGCTCGGGGGCGGG - Exonic
1099342233 12:81451447-81451469 AGGCTGCGTGTTTCTGGGACTGG + Intronic
1101785144 12:107875953-107875975 GGGCGCCCCGGTGCTGGTACAGG - Intergenic
1103491905 12:121327940-121327962 GGGCTCCTCTGCTCTGTGACAGG - Intronic
1107042830 13:35967195-35967217 GGGCTCCTCAGTTCTCAGACGGG - Intronic
1113329125 13:109311626-109311648 GGGCTCCTCACTTCTGGGACAGG - Intergenic
1113735802 13:112678499-112678521 GGGCTCCTCACTTCTGGGACAGG + Intronic
1113750165 13:112771367-112771389 TGTCTCCTGGGTTCTGGGACGGG + Intronic
1115474372 14:33799771-33799793 GGTCTTCGCTGTTCTCGGACTGG - Exonic
1118253254 14:64183100-64183122 GGGCTCCTCACTTCTCGGACGGG + Intronic
1118253267 14:64183140-64183162 GGGCTCCTCACTTCTCGGACGGG + Intronic
1118890339 14:69903309-69903331 GGGCTCCTCAGTTCTCAGACGGG - Intronic
1120789215 14:88563458-88563480 GGGCGCCGCGGGGCTGGGGCTGG + Intronic
1122081639 14:99271100-99271122 GGGCTCCGGGCGTCTGGGGCTGG - Intronic
1122961902 14:105097812-105097834 GGGCTACGTGGTTCAGGGACAGG - Intergenic
1128061222 15:64737042-64737064 GGGGTCCAGAGTTCTGGGACAGG - Intergenic
1129664616 15:77572592-77572614 GGGCTCTGTGGATCTGGCACTGG + Intergenic
1131523384 15:93133794-93133816 GGGCTCCGTGGTTCTGGTGATGG - Intergenic
1132738905 16:1401239-1401261 GGGCGCCCCGGCTCTGGGACAGG + Intronic
1132797985 16:1734599-1734621 GGGGTCAGGGGTGCTGGGACAGG + Intronic
1132921833 16:2400027-2400049 GGGCTCCTCACTTCTCGGACGGG + Intergenic
1134492172 16:14703439-14703461 GGGCCCCGCGGCCCTGGGATGGG - Intergenic
1134497553 16:14742561-14742583 GGGCCCCGCGGCCCTGGGATGGG - Intronic
1136267979 16:29131996-29132018 GGGCCCAGCGGTGCTGGAACAGG + Intergenic
1137722253 16:50634085-50634107 GGGCTCCCTGGCTCTGGGAAGGG - Exonic
1141690053 16:85591521-85591543 GGGCTCAGCGGTGCTGGGGAGGG + Intergenic
1142071286 16:88092334-88092356 GGGCCCAGCGGTGCTGGAACAGG + Intronic
1142126614 16:88413769-88413791 GGGCTCCGCGCCTCAGGGCCTGG + Intergenic
1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG + Intergenic
1142156008 16:88533197-88533219 GGCCTCCGCGGACCTGGGCCTGG + Exonic
1142227798 16:88885930-88885952 GGGCTCCGGGGATCTGGGCTGGG - Intronic
1142468068 17:147258-147280 GGGCTCAGCCACTCTGGGACGGG - Exonic
1142666074 17:1464567-1464589 GGGCTCCCTGGCTCTGGGAGTGG + Exonic
1144642370 17:16944662-16944684 GAGCTCCATGGGTCTGGGACAGG + Intronic
1144728277 17:17512566-17512588 GGGCCTCGCGCTCCTGGGACTGG - Exonic
1144869987 17:18363409-18363431 TGGGTCAGCGGGTCTGGGACTGG - Exonic
1147636595 17:41967781-41967803 GGAGCCTGCGGTTCTGGGACTGG - Intronic
1148563434 17:48619427-48619449 GGGCTCCGGGCTTCCGGGGCGGG - Intronic
1149699022 17:58639670-58639692 AGGCTCCACGGTTCTGGTAAAGG + Intronic
1150518292 17:65837534-65837556 GGGCTCCTCACTTCTCGGACAGG - Intronic
1160857736 19:1224906-1224928 GGGCTCTGCAGGTCAGGGACGGG - Intronic
1160921247 19:1521801-1521823 GGGCTGCGAGGCTCTGGGCCAGG + Intergenic
1161809848 19:6465323-6465345 GGGCTCTGCGGGACTGGGTCGGG + Intronic
1161925142 19:7294153-7294175 GGGCCCCGAGATCCTGGGACGGG - Intergenic
1162298258 19:9828130-9828152 GGGGTTCGCGGCCCTGGGACAGG + Intronic
1163719812 19:18893773-18893795 GGCCGCCGCGGTGCTGGGAGGGG + Intronic
1164126261 19:22321700-22321722 GGGCTCCTCGCTTCTCAGACGGG + Intergenic
1167377450 19:49119554-49119576 GGGCTCCGCGTCTCTGGCTCCGG - Exonic
1167424554 19:49423380-49423402 GGGGCCCGGGGTTCTGGGCCGGG - Exonic
1168407602 19:56119067-56119089 GGTCTCAGCTGCTCTGGGACAGG + Intronic
1168652172 19:58098195-58098217 GGGCTCCGGGCGGCTGGGACCGG - Intronic
926671070 2:15577376-15577398 GGACTCAGCAGGTCTGGGACGGG - Intergenic
927047316 2:19292300-19292322 GGGCTCTGCAGTTCTGGCACAGG - Intergenic
930665600 2:54096137-54096159 GGGCTCCTCACTTCTCGGACGGG + Intronic
932180622 2:69643425-69643447 GGGGTCCCGGGTTCTGGGGCCGG - Intronic
935844659 2:107152473-107152495 GAGCTCTGCAGTTTTGGGACTGG + Intergenic
937274185 2:120673612-120673634 GGGGACCGAGGTTCTGGGAGGGG - Intergenic
948457806 2:238115023-238115045 TGGCTCTGCGGTTCTGGCGCTGG + Intronic
948588833 2:239036932-239036954 GGGCACCTCGGTTCAGGGACAGG - Intergenic
948826347 2:240575094-240575116 GGTCTCCGCAGAGCTGGGACAGG - Exonic
948909412 2:240995563-240995585 GGGATCAGCGCTTCTGGGGCAGG + Intergenic
1170475595 20:16711091-16711113 GGCCTCCCCGCTTCTGGGAAAGG - Intergenic
1170569813 20:17626428-17626450 GGGCTCTGCGGCTTGGGGACTGG - Intronic
1170881327 20:20298760-20298782 GGACTCCGCGATCATGGGACGGG + Intronic
1171463650 20:25312873-25312895 GGGCTCCGCACTTCTCAGACGGG - Intronic
1172401961 20:34658804-34658826 GGGCTCCTCGCTTCTCAGACGGG - Intronic
1174218883 20:48936474-48936496 GGGCTCCTCACTTCTCGGACGGG + Intronic
1175049425 20:56140602-56140624 GGACTCCAAGGTTCTGGCACAGG + Intergenic
1175117709 20:56694708-56694730 GGGCTCCTGGTTTCTGTGACAGG - Intergenic
1175275950 20:57770948-57770970 GGGCTCTGCAGTCCTGGGCCGGG + Intergenic
1175925514 20:62469421-62469443 GGGACCCTCGGGTCTGGGACCGG + Intronic
1179459601 21:41524984-41525006 GGGCAGCGGGGTTTTGGGACTGG - Intronic
1181273986 22:21677114-21677136 GGGCTCCTCGCTTCTCAGACGGG + Intronic
1183094826 22:35545795-35545817 GGGGTCAGGGGTTCTGGGGCGGG + Intronic
1184399878 22:44267597-44267619 GGGCTTCTCGGTCCAGGGACAGG - Intronic
1184722987 22:46326281-46326303 GAGCTCCGCTCTCCTGGGACAGG - Intronic
1185315024 22:50175254-50175276 GGGCTCCTTGGCTCTGGGGCAGG - Intronic
949477966 3:4466923-4466945 GGGCTGCTCGGTTCCTGGACGGG - Intronic
953885927 3:46714372-46714394 GGGCCCAGCGGTTCTGGTCCTGG - Exonic
957035462 3:75289517-75289539 GGGCTCCGCACTTCTCAGACGGG - Intergenic
959919969 3:111859447-111859469 GGGCTCCGCGCGGCTGGGTCCGG - Exonic
963249089 3:143086812-143086834 GGGCTCCTCACTTCTCGGACGGG + Intergenic
964327416 3:155562410-155562432 GGGCTCCATGGTTCTAGGAAAGG - Intronic
969559890 4:7939999-7940021 GGGCGGGGCGGTGCTGGGACTGG + Exonic
975404791 4:73976835-73976857 GGGCCCAGCAGTGCTGGGACTGG - Intergenic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
981031988 4:140134941-140134963 GGGCTACTCGGTCCTGGGAGAGG - Intronic
986658768 5:10040743-10040765 GGGCTCTGCTCTTCTGGCACAGG - Intergenic
988779113 5:34503062-34503084 GGGCTCCACGGGGCTGTGACTGG - Intergenic
990501097 5:56397920-56397942 GGGCTCCTCAGTTCTCAGACGGG + Intergenic
991377055 5:65977421-65977443 GGGCTCCTCACTTCTCGGACGGG + Intronic
992442978 5:76812376-76812398 GGGCTCCTCACTTCTGAGACGGG - Intergenic
997870063 5:137498862-137498884 GGGCTCCCCGCTTCTGGGGAGGG - Intronic
999326669 5:150648404-150648426 GGGCCTCTCGGTTTTGGGACAGG - Exonic
1002424996 5:179169628-179169650 GGGCCCTGGGGATCTGGGACAGG - Intronic
1003645414 6:7910248-7910270 GGGCGCCGCGGCTCGGGGCCGGG - Intronic
1006521465 6:34573576-34573598 GGGCTCCTCCTTTCTGGGAATGG - Intergenic
1006642995 6:35497949-35497971 GGGCTCCGAGGAGCTGGGGCGGG - Exonic
1006893165 6:37447338-37447360 GGGCTCATGGGTTCTGGGGCCGG + Intronic
1010400612 6:75442018-75442040 GGGCTCCTCACTTCTGGGACGGG + Intronic
1011228860 6:85137514-85137536 GGGCTCCGCGGGACAGGCACAGG + Intergenic
1013474978 6:110498824-110498846 GGGCTCCGTGGAGCAGGGACAGG - Intergenic
1016427133 6:143946919-143946941 GTGCTGCACGGTACTGGGACTGG - Intronic
1016874813 6:148854221-148854243 GGGCTCAGCGGTACAGGGACAGG - Intronic
1019324653 7:432204-432226 AGGCTCCGCCGTCCTGGGGCTGG + Intergenic
1019440009 7:1041222-1041244 GGGCTCCGCGCTGCGGGGAAGGG + Intronic
1019440019 7:1041250-1041272 GGGCTCCGCGCTGCGGGGAAGGG + Intronic
1019440029 7:1041278-1041300 GGGCTCCGCGCTGCGGGGAAGGG + Intronic
1022179039 7:27900050-27900072 GGGCTCCCCGGTTGTGGCAGGGG + Intronic
1023843741 7:44109940-44109962 GGGCTCCTTGGTTCTGGGTTTGG + Intronic
1024209310 7:47190306-47190328 AGGCTCTGCTGTACTGGGACTGG - Intergenic
1024940981 7:54763102-54763124 AGTCTCCGCGGATCTGGCACAGG + Intergenic
1025142515 7:56477984-56478006 GGGCTCCACGGGTCTGGGGAAGG - Intergenic
1025573008 7:62599912-62599934 GGGCTCCTCCCTTCTCGGACAGG + Intergenic
1025610875 7:63074616-63074638 GGGCTCCACGGGTCTGGGGAAGG + Intergenic
1025708574 7:63888592-63888614 GGGCTCCACGGGTCTGGGGAAGG - Intergenic
1028685636 7:93586350-93586372 GGGCTCCTCGCTTCTCAGACGGG + Intergenic
1029453573 7:100656014-100656036 GGAGTCCGAGGTCCTGGGACTGG + Intronic
1032509974 7:132465007-132465029 GGGCTCCCCGGGGCTGGGTCAGG - Intronic
1032589363 7:133177631-133177653 GGGCTCCTCACTTCTCGGACGGG - Intergenic
1033156850 7:138964309-138964331 GGTCTCCTCTGTTCTGGGTCTGG - Intronic
1034274917 7:149819811-149819833 GGGCTCCCCCGTTCTTGGATGGG - Intergenic
1034522736 7:151632620-151632642 GGGCTCCGCGGCGCGGGGAGGGG + Intronic
1035897999 8:3425637-3425659 GGGCTCCCTGCTGCTGGGACAGG - Intronic
1037753910 8:21699448-21699470 GGGCTCCCTGGTGCTGGGAAAGG + Intronic
1040444980 8:47484396-47484418 GGGCTCAGCTGTCCTGGGCCAGG + Intronic
1049442636 8:142616261-142616283 GGGCACCGCGGAGCTGGGAGGGG + Intergenic
1049481626 8:142827077-142827099 GGGCTCCTCGCTTCTCAGACGGG + Intergenic
1049605034 8:143525429-143525451 GGGCTCAGCTGTTCTGGAAAGGG - Intronic
1049627918 8:143634551-143634573 GGGCTCCCCGGCTCTTGGAAAGG - Intergenic
1056097824 9:83272871-83272893 GGGCTCCTCACTTCTCGGACGGG - Intronic
1059145576 9:111896751-111896773 GGGCGCCGCGGTTCCGGGGGCGG + Exonic
1060402950 9:123358691-123358713 GGGCTTCCTGGCTCTGGGACTGG - Intronic
1061143072 9:128780248-128780270 GGGCTCCGCACTTCTCAGACGGG - Intergenic
1061273660 9:129557801-129557823 GGGCTTCGGGCTTCTGGGCCTGG - Intergenic
1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG + Intronic
1188440874 X:30214781-30214803 GGGCTCCTCTGTTCTGGGGTGGG - Intergenic
1195585905 X:106565374-106565396 GGGCTAAACAGTTCTGGGACTGG + Intergenic
1197455670 X:126673990-126674012 GGGCTCCGCACTTCTGAGATGGG - Intergenic
1198158626 X:133985780-133985802 GGGCACCGCGGCGCGGGGACCGG + Intronic