ID: 1187510224

View in Genome Browser
Species Human (GRCh38)
Location X:19910903-19910925
Sequence GAGTTAGCTGCCCCTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187510224_1187510229 -6 Left 1187510224 X:19910903-19910925 CCCAGAGGAGGGGCAGCTAACTC No data
Right 1187510229 X:19910920-19910942 TAACTCAGCGAGGCTAGGTTGGG No data
1187510224_1187510233 29 Left 1187510224 X:19910903-19910925 CCCAGAGGAGGGGCAGCTAACTC No data
Right 1187510233 X:19910955-19910977 CTGAGTCTTGTTTATCCAGATGG No data
1187510224_1187510228 -7 Left 1187510224 X:19910903-19910925 CCCAGAGGAGGGGCAGCTAACTC No data
Right 1187510228 X:19910919-19910941 CTAACTCAGCGAGGCTAGGTTGG No data
1187510224_1187510230 -2 Left 1187510224 X:19910903-19910925 CCCAGAGGAGGGGCAGCTAACTC No data
Right 1187510230 X:19910924-19910946 TCAGCGAGGCTAGGTTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187510224 Original CRISPR GAGTTAGCTGCCCCTCCTCT GGG (reversed) Intergenic
No off target data available for this crispr