ID: 1187518701

View in Genome Browser
Species Human (GRCh38)
Location X:19994825-19994847
Sequence CAGCACAAGTAGATGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187518699_1187518701 0 Left 1187518699 X:19994802-19994824 CCAGACTCACAATTGTCAACAGA No data
Right 1187518701 X:19994825-19994847 CAGCACAAGTAGATGGTCCTTGG No data
1187518698_1187518701 25 Left 1187518698 X:19994777-19994799 CCTCTTTGAACAAGGTGGTCTTT No data
Right 1187518701 X:19994825-19994847 CAGCACAAGTAGATGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187518701 Original CRISPR CAGCACAAGTAGATGGTCCT TGG Intergenic
No off target data available for this crispr