ID: 1187518701 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:19994825-19994847 |
| Sequence | CAGCACAAGTAGATGGTCCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187518699_1187518701 | 0 | Left | 1187518699 | X:19994802-19994824 | CCAGACTCACAATTGTCAACAGA | No data | ||
| Right | 1187518701 | X:19994825-19994847 | CAGCACAAGTAGATGGTCCTTGG | No data | ||||
| 1187518698_1187518701 | 25 | Left | 1187518698 | X:19994777-19994799 | CCTCTTTGAACAAGGTGGTCTTT | No data | ||
| Right | 1187518701 | X:19994825-19994847 | CAGCACAAGTAGATGGTCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187518701 | Original CRISPR | CAGCACAAGTAGATGGTCCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||