ID: 1187521644

View in Genome Browser
Species Human (GRCh38)
Location X:20019565-20019587
Sequence TTGTGTCAGTGACATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187521644_1187521647 6 Left 1187521644 X:20019565-20019587 CCTTCCTCATGTCACTGACACAA 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1187521647 X:20019594-20019616 ACTTGAATTGTTCAATCTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 163
1187521644_1187521650 28 Left 1187521644 X:20019565-20019587 CCTTCCTCATGTCACTGACACAA 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1187521650 X:20019616-20019638 GACGAGTATGTGGGTTTCACTGG 0: 1
1: 0
2: 0
3: 2
4: 98
1187521644_1187521649 19 Left 1187521644 X:20019565-20019587 CCTTCCTCATGTCACTGACACAA 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1187521649 X:20019607-20019629 AATCTGAGGGACGAGTATGTGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1187521644_1187521646 5 Left 1187521644 X:20019565-20019587 CCTTCCTCATGTCACTGACACAA 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1187521646 X:20019593-20019615 AACTTGAATTGTTCAATCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 192
1187521644_1187521648 18 Left 1187521644 X:20019565-20019587 CCTTCCTCATGTCACTGACACAA 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1187521648 X:20019606-20019628 CAATCTGAGGGACGAGTATGTGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187521644 Original CRISPR TTGTGTCAGTGACATGAGGA AGG (reversed) Intronic
901546342 1:9960683-9960705 TTGTCACAGTGAGCTGAGGAGGG + Intronic
902690682 1:18108577-18108599 CTGTGTCAGTTACATGGAGAAGG + Intronic
902756935 1:18555241-18555263 TTATAGCAGTGACATGAGGATGG - Intergenic
903279534 1:22242612-22242634 AGGTGGCAGTGACAGGAGGAGGG + Intergenic
903369840 1:22828192-22828214 TTGTGTCAGTGACTAGAGCAGGG + Intronic
904512793 1:31027494-31027516 TTGTGTCAGTGACATTAGGCAGG + Intronic
905315071 1:37077302-37077324 TTGTGGTAGAGGCATGAGGAGGG + Intergenic
905316447 1:37084493-37084515 TTCTGCCAGTGACTTCAGGATGG + Intergenic
905354396 1:37371293-37371315 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
905821888 1:40999103-40999125 CTGTGGCAGACACATGAGGAAGG + Intronic
908445445 1:64195581-64195603 TTGAGTCACTGACTTCAGGAAGG + Intergenic
909094860 1:71274139-71274161 CTGTGACAGTGACATCAGAAGGG + Intergenic
909172306 1:72312962-72312984 TTGAGTCAGTGAACTGAGGAAGG - Intergenic
909264815 1:73543338-73543360 TTGTGTCAGTGACTTTTAGAGGG + Intergenic
909549399 1:76880705-76880727 TTGAGTCAGTGAGCTGGGGAAGG - Intronic
909603842 1:77488806-77488828 TTGAGTCAGTGGTCTGAGGAAGG - Intronic
910106751 1:83639551-83639573 TTCTTTAAGTGACATGGGGATGG - Intergenic
910562207 1:88602427-88602449 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
913011245 1:114685921-114685943 GTGGGTCAGTTACATGAGAAGGG + Intronic
913522476 1:119658490-119658512 GAGTTTCAGTGACATGAGCATGG + Intergenic
914350604 1:146836390-146836412 ATGTGTCAGGGACATGCAGAGGG + Intergenic
915051229 1:153074985-153075007 GTATGTCAGTGCTATGAGGATGG - Intergenic
915119079 1:153617334-153617356 TTGAGAAGGTGACATGAGGAGGG - Intergenic
916368208 1:164058012-164058034 TTAAGTCACTAACATGAGGATGG - Intergenic
916606473 1:166347448-166347470 ATGTGTCAAGGACCTGAGGATGG + Intergenic
917216908 1:172688428-172688450 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
919112738 1:193241343-193241365 TGGGGTCAGTGACATCAGGCAGG + Intronic
919138843 1:193544638-193544660 TTATATCAGTGATATGAGAAAGG + Intergenic
919653330 1:200172575-200172597 TTGGGTCAGAGACTTGGGGATGG + Intronic
919733440 1:200929158-200929180 TTGTGTCAGGCACACGATGAAGG + Intergenic
922403771 1:225289569-225289591 TATTGACAGTGACATGAAGATGG + Intronic
922520654 1:226248196-226248218 TTCTGTCACTGAGATGAAGAAGG + Intronic
923813015 1:237341883-237341905 CTGTGTCAGGCAAATGAGGATGG - Intronic
924708735 1:246517970-246517992 GTGTGTCTGTGGCCTGAGGATGG - Intergenic
1063150026 10:3328510-3328532 TTGTGTCAGTGATGTGTTGATGG + Intergenic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1067971820 10:50980346-50980368 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1068327727 10:55516206-55516228 TTTTTTCAGTGTCATGAGAACGG - Intronic
1068519164 10:58060409-58060431 TGGAGTCAGTCACATAAGGAAGG + Intergenic
1068654571 10:59561494-59561516 TTGTGTGAGTGACATAGAGAAGG - Intergenic
1069211193 10:65761724-65761746 TTGGGTCAGTGGGTTGAGGAAGG - Intergenic
1071761936 10:88617506-88617528 TTTTGTCACTGACATAAGAACGG + Intergenic
1071943243 10:90611357-90611379 TTGAGTCAGTGAGCTGGGGAAGG - Intergenic
1073667092 10:105545784-105545806 TTGAGTCAGTGAATGGAGGAAGG + Intergenic
1076273450 10:129176291-129176313 ATCTGTCACTGACATGAGAAAGG + Intergenic
1076737624 10:132465835-132465857 CTGTCTCCGTGACATCAGGAGGG + Intergenic
1077300371 11:1843950-1843972 TTGGCTGAGGGACATGAGGAAGG + Intergenic
1079332158 11:19542424-19542446 TGGAGTCAGTGAATTGAGGAAGG + Intronic
1080101387 11:28463936-28463958 TTTTGTTTCTGACATGAGGAAGG - Intergenic
1080952174 11:37047208-37047230 TTGTGTATGTGGCATGAGGTAGG + Intergenic
1081578590 11:44335233-44335255 TTGTGTGAGTGAAAGCAGGAGGG - Intergenic
1083088811 11:60178729-60178751 TTGTGTCAGTGACATTATGTTGG + Intronic
1083670491 11:64297327-64297349 ATGTGCCAGGGACATGGGGAAGG - Intronic
1084312558 11:68325389-68325411 TTGTGTTAGTGTGAAGAGGAGGG + Intronic
1084728286 11:71056382-71056404 TTGTATGTGTGACATGAGGTCGG - Intronic
1084801467 11:71547052-71547074 TGGCCTCAGTGACTTGAGGAGGG + Intronic
1085861668 11:80243084-80243106 ATGTGTGAGTGGCATGATGATGG - Intergenic
1087899176 11:103621354-103621376 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
1088412734 11:109553284-109553306 TTGAGTCATTGACATGAAGACGG + Intergenic
1088446860 11:109940209-109940231 TGGTGTCAGTGACACAGGGATGG - Intergenic
1088836966 11:113585834-113585856 TTGAGTCAGTGAGATGGGCAAGG + Intergenic
1091638857 12:2219007-2219029 TTGTGTGCTTGACATGTGGAAGG + Intronic
1093218623 12:16391914-16391936 TTTTGTATGTGGCATGAGGAAGG + Intronic
1093500887 12:19810602-19810624 TTGGGAAAGTGACATCAGGAAGG + Intergenic
1095742356 12:45621238-45621260 TTGTCACAGTGACTGGAGGAAGG + Intergenic
1097604196 12:61732263-61732285 TGGTGTCAGTGAAATAAGCAAGG + Intronic
1100747719 12:97663896-97663918 TTGCATCATTAACATGAGGAGGG - Intergenic
1104683414 12:130768020-130768042 TTATTCCAGTGACATTAGGAAGG + Intergenic
1105366487 13:19770031-19770053 TTTTGTCCGTGACATATGGATGG - Intronic
1107044188 13:35977673-35977695 TGTTGGCAGTGACATGAAGAAGG + Intronic
1107564110 13:41584333-41584355 TTCTGTCTGTGGAATGAGGATGG + Intronic
1108263063 13:48677749-48677771 TTGAGACAGTGACCTCAGGAAGG - Intronic
1108749448 13:53432612-53432634 TGGTCTTAGAGACATGAGGATGG - Intergenic
1109951467 13:69505835-69505857 TTGAGTCAGTGGCCTGGGGAAGG - Intergenic
1110261190 13:73487036-73487058 TTGTGTTAGGGAAATCAGGAAGG + Intergenic
1110526433 13:76543619-76543641 TTCTGCCATTGAAATGAGGATGG - Intergenic
1110644391 13:77865800-77865822 ATGTGTCAGTCACCTCAGGATGG + Intergenic
1111693818 13:91597646-91597668 TTTTGTTAGGTACATGAGGAGGG + Intronic
1113087462 13:106582875-106582897 TTGTGGCAGTGAAGTGTGGAGGG - Intergenic
1113918152 13:113886944-113886966 GTGTGTCAGTGACAGGACGGTGG - Intergenic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1116316934 14:43409052-43409074 ATGTGTCATTGGCAAGAGGACGG + Intergenic
1116677391 14:47923265-47923287 TTGTGTTAGTGAAATAAGCAAGG - Intergenic
1118060189 14:62128807-62128829 TTCTGTAAATGATATGAGGAAGG + Intergenic
1119107239 14:71936394-71936416 TTGTGTCAGTGGGCTGTGGAAGG - Intronic
1119956562 14:78804412-78804434 TTGAGTCTGTGACACGTGGAAGG + Intronic
1120974051 14:90233581-90233603 TTGAGTCAGTGACCTGGGAAGGG + Intergenic
1122138609 14:99648896-99648918 GAGTGTCAGTGACATGGGGGTGG + Intronic
1122281080 14:100622784-100622806 TTGTAACAGTGCCGTGAGGAAGG + Intergenic
1122983038 14:105200129-105200151 GTGTGACAGTGTCATGAGGAGGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1125900197 15:43339114-43339136 TGGTGTCAGTGACAGCAAGAGGG + Intronic
1126283906 15:46988683-46988705 TTGAGTCAGTGAACTGAGAAAGG + Intergenic
1126315325 15:47363640-47363662 TTGTGCCAGTGACAAGGGCAAGG + Intronic
1127371542 15:58346231-58346253 TTGTGTCAGTGCACTGAGTAAGG - Intronic
1127693880 15:61424946-61424968 TTTTGTCAGAAACCTGAGGAAGG - Intergenic
1127829876 15:62741236-62741258 TTGTATCTGTCACATGGGGAAGG + Intronic
1128114067 15:65094521-65094543 TTACGTCAGGGATATGAGGAAGG - Exonic
1129662114 15:77558809-77558831 TTGAGGCAATGACAAGAGGAGGG - Intergenic
1133527324 16:6618137-6618159 GTGTTACAGGGACATGAGGAGGG + Intronic
1134349458 16:13423112-13423134 ATGAGTCAGTGACTTGAAGATGG + Intergenic
1136398503 16:30005545-30005567 TTGTGTCAGTGGCCGGAGCATGG - Exonic
1139041470 16:63004058-63004080 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1139241159 16:65393639-65393661 TTGGGTCACTGACAGTAGGAAGG - Intergenic
1139291240 16:65859805-65859827 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1139983432 16:70879149-70879171 ATGTGTCAGGGACATGCAGAGGG - Intronic
1142957874 17:3533452-3533474 TTCTGTCTGGGACAAGAGGAGGG - Intronic
1143033562 17:3981830-3981852 TTGTGTCATTCACAGGGGGAGGG - Intergenic
1143204508 17:5132697-5132719 GTGTGTCTGTGGCCTGAGGATGG + Intronic
1144299118 17:13906603-13906625 TTGCCACAGTGACATGAGCAAGG + Intergenic
1145760235 17:27421415-27421437 GTGTGTCTGTGGCCTGAGGATGG + Intergenic
1145798821 17:27670911-27670933 GTGTGTCTGTGGCCTGAGGATGG - Intergenic
1146160252 17:30555687-30555709 GTGTGTCTGTGGCCTGAGGATGG + Intergenic
1146663134 17:34678485-34678507 CTCTGGCAGTGACATGATGATGG - Intergenic
1146814416 17:35930888-35930910 TTGTGGCTGTGACTGGAGGAGGG - Intergenic
1146844151 17:36173116-36173138 GTGTGTCTGTGGCCTGAGGATGG - Intronic
1146856456 17:36261051-36261073 GTGTGTCTGTGGCCTGAGGATGG - Intronic
1146864161 17:36327324-36327346 GTGTGTCTGTGGCCTGAGGATGG + Intronic
1146872366 17:36384962-36384984 GTGTGTCTGTGGCCTGAGGATGG - Intronic
1146879724 17:36436047-36436069 GTGTGTCTGTGGCCTGAGGATGG - Intronic
1147067021 17:37927912-37927934 GTGTGTCTGTGGCCTGAGGATGG + Intronic
1147075250 17:37985586-37985608 GTGTGTCTGTGGCCTGAGGATGG - Intronic
1147078553 17:38007473-38007495 GTGTGTCTGTGGCCTGAGGATGG + Intronic
1147086775 17:38065132-38065154 GTGTGTCTGTGGCCTGAGGATGG - Intronic
1147094491 17:38131408-38131430 GTGTGTCTGTGGCCTGAGGATGG + Intergenic
1147102720 17:38189095-38189117 GTGTGTCTGTGGCCTGAGGATGG - Intergenic
1148461231 17:47840155-47840177 GTGTGTCAGGCAGATGAGGAAGG + Intronic
1150517597 17:65830349-65830371 TTGTGTGAGGGACATTATGATGG - Intronic
1152723114 17:81932518-81932540 TTCTGTCTGCCACATGAGGAGGG - Intronic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1156619147 18:38828195-38828217 TTGAGTCAGTGGCATGGGGAAGG - Intergenic
1156647239 18:39179842-39179864 TTGAATCAGGGATATGAGGAAGG + Intergenic
1158270843 18:55714474-55714496 TGGTCTCAGTGAAGTGAGGAAGG - Intergenic
1158399531 18:57109307-57109329 TTGTGTGAGTGCCAAGAGCAAGG - Intergenic
1159292049 18:66435648-66435670 TTGTGTCAGTGGGCTGGGGAAGG - Intergenic
1160855115 19:1213771-1213793 TTGTTTCAGCCACATCAGGAGGG + Intronic
1161088956 19:2350794-2350816 TTACGTCAGGGACATGAGCAAGG + Intronic
1162340688 19:10089908-10089930 TTCTGTCAGTGGCAGGAGGGAGG - Exonic
1163158433 19:15451261-15451283 TGGCCTCCGTGACATGAGGAGGG + Intergenic
1164281373 19:23771809-23771831 TTGTGTTATTGACATGTGGCTGG + Intronic
1166071840 19:40392634-40392656 GTGAGACAGTGACCTGAGGAGGG + Intergenic
1166944091 19:46386546-46386568 TTGTGTCTGAGACAGAAGGATGG + Intronic
1168304967 19:55430232-55430254 GTGAGGCAGTGACATAAGGAGGG + Exonic
1168426815 19:56245653-56245675 TGGTCTCAGTGAAATGAGGGAGG + Intronic
1168482895 19:56736405-56736427 TTGTGACATTCACAAGAGGAGGG - Intergenic
925625208 2:5836189-5836211 TTCTCTCAGCCACATGAGGAGGG - Intergenic
925673438 2:6335673-6335695 TTGAGTCAGTGAGCTGAGAAAGG - Intergenic
925794593 2:7528343-7528365 TTGTGTCAGTGAGCTGGGAAAGG - Intergenic
925935596 2:8755842-8755864 ATGTGTCACAGGCATGAGGATGG - Intronic
926373144 2:12200624-12200646 TATTTTTAGTGACATGAGGAAGG + Intergenic
926617186 2:15008513-15008535 TTGTGGAAGGGACATGAGAAAGG - Intergenic
926887384 2:17610729-17610751 ATGTGTCAGTGACATGGGACTGG + Intronic
928656779 2:33460404-33460426 TTATCTCAGTGAAATGAGAATGG + Intronic
931173605 2:59830755-59830777 TGGTGTCAGGGAAATGAGGCTGG - Intergenic
932174363 2:69586021-69586043 TTGGGGCAGTGACGTGCGGAGGG - Intronic
932901281 2:75703599-75703621 TACTGTCAGGGACATGATGAAGG + Intronic
932983646 2:76699847-76699869 CTATCTCAGTGACATGAGAAAGG - Intergenic
933230179 2:79797953-79797975 TTGTGTCAGTGTCAGTAAGAGGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936530542 2:113273631-113273653 TTGTGTGTGTGACTTGGGGAGGG - Intronic
937175874 2:119934350-119934372 TTGTGTGACTGTCAAGAGGATGG + Intronic
937363436 2:121244522-121244544 TGGTCTCAGTGCCCTGAGGAAGG - Intronic
939149744 2:138458993-138459015 TTGGGTCAATGAAATGAAGATGG + Intergenic
940300524 2:152172419-152172441 TTCTGACAGTCATATGAGGAAGG - Intronic
940386494 2:153079572-153079594 TAGTGTCAGGGAAATCAGGACGG + Intergenic
940678492 2:156754186-156754208 TTATGTCAGAGAAATGGGGAGGG - Intergenic
941815767 2:169794441-169794463 TTGTGTATGGGTCATGAGGATGG - Intronic
942504758 2:176629862-176629884 TTGTGTCAGTTACAGCATGATGG + Intergenic
942569843 2:177302756-177302778 TTGCTTCAGTGCCGTGAGGAAGG + Intronic
942775493 2:179576438-179576460 TAGTGTAAATGACATGATGAAGG - Intronic
942817390 2:180067757-180067779 TTGTTTCAAAGACATGAGGCAGG - Intergenic
943444270 2:187964164-187964186 TCATGTCAGTGACATGAAAAAGG + Intergenic
945827448 2:214741136-214741158 TTATGTCTGTGAGATGGGGAAGG - Intronic
945907121 2:215606620-215606642 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
945986159 2:216355452-216355474 GTGTGTCTTTGACATGAGGCTGG - Intronic
946456895 2:219833808-219833830 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
947481750 2:230507063-230507085 TTGTTAGAGTGGCATGAGGAAGG - Intronic
948721512 2:239903893-239903915 TTGTGTCATTGAGATCAGGTGGG + Intronic
948846762 2:240687031-240687053 ATTTGTCAGTGAGCTGAGGAAGG + Intergenic
1168974066 20:1951031-1951053 CTGTGGCAGTGACATGGGCAGGG + Intergenic
1172766331 20:37352997-37353019 ATGTGTCAGAGCCATGAGGAAGG - Intronic
1173095453 20:40023534-40023556 TTGTGTAAGTGACATATTGAGGG - Intergenic
1174187116 20:48714056-48714078 TTTTGTGTGTGGCATGAGGAAGG - Intronic
1175121668 20:56720772-56720794 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
1177030020 21:15970896-15970918 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1177101893 21:16908278-16908300 TTGATTCACTGGCATGAGGAAGG + Intergenic
1181493312 22:23274234-23274256 TTGTGTCTGTGACGTGAGACTGG + Intronic
1182006212 22:26961767-26961789 GGGTGCCAGTGACATTAGGAAGG + Intergenic
949255789 3:2044378-2044400 TTGTGACTGTAACATAAGGAAGG + Intergenic
951290941 3:20871738-20871760 TTGAGTCAGTGGACTGAGGAAGG + Intergenic
951567619 3:24026985-24027007 TTGTGAGAGTCACATGAGGATGG - Intergenic
953070710 3:39516564-39516586 TGGGGTCAGAGGCATGAGGATGG + Intronic
953483485 3:43272677-43272699 TTATGCCATTCACATGAGGAGGG + Intergenic
954852336 3:53614264-53614286 TTGTTTTTGTGTCATGAGGATGG + Intronic
955548793 3:60060216-60060238 TTGAGTGTGTAACATGAGGATGG - Intronic
956213284 3:66823871-66823893 TTGTGCCAGGGACATGAGGTGGG + Intergenic
957555239 3:81758518-81758540 TTGAGTGACTGCCATGAGGAGGG + Intronic
958608135 3:96386937-96386959 TTTTGTAAGTGGCATGAGGAAGG + Intergenic
959321246 3:104878039-104878061 TTGTGTCTTTGACAGGAGAAAGG - Intergenic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961722147 3:128903856-128903878 GTGTGTGGGTGCCATGAGGAGGG + Intronic
961774820 3:129277480-129277502 TTCTGCCAGTTTCATGAGGAAGG - Exonic
962381577 3:134902340-134902362 TTGAGTCACTGGCAGGAGGAAGG + Intronic
962674753 3:137746953-137746975 ACGTGTCAGTAAGATGAGGATGG - Intergenic
962726294 3:138230982-138231004 TTCTGTCAGTGGTATGAGGCTGG - Intronic
963629855 3:147719605-147719627 TTGTGTCAGTGGGCTGGGGAAGG + Intergenic
963630612 3:147725688-147725710 TTGAGTCAGTGGGATGGGGAAGG + Intergenic
963970000 3:151419510-151419532 TTGAGTCAGTGCGATGGGGAAGG - Intronic
964338897 3:155687745-155687767 ATCAGTCAGTGACAGGAGGATGG - Intronic
966441960 3:179955177-179955199 ATGCTTCTGTGACATGAGGAAGG - Intronic
967041026 3:185692219-185692241 TTGTGTGTGTAACATTAGGAGGG - Intronic
967498119 3:190164499-190164521 TTGAGTCAGTGAGCTGAGGAAGG - Intergenic
967505739 3:190250989-190251011 TTGTGTCAGTGGGTTGGGGAGGG - Intergenic
968071280 3:195785897-195785919 TAGTGTCGGTGACAGGAAGAGGG + Exonic
968071704 3:195788297-195788319 AAGTGTCAGTGACAGGAAGAGGG + Exonic
968071721 3:195788393-195788415 AAGTGTCAGTGACAGGAAGAGGG + Exonic
970957519 4:21832376-21832398 TTGTGGCTCTGACATAAGGATGG + Intronic
971334808 4:25712539-25712561 TTTTGTATGTGATATGAGGAAGG + Intergenic
972727677 4:41759745-41759767 TTTTGTCAGTGGCATGATTACGG + Intergenic
972964747 4:44495575-44495597 TTGAGTCAGTGAACTGAGGAAGG - Intergenic
973092557 4:46156711-46156733 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
975242297 4:72075088-72075110 TTGAGTCAGTGGGCTGAGGAAGG + Intronic
976354586 4:84102393-84102415 TTGAGTCAGTGGCCTGGGGAAGG + Intergenic
976671343 4:87657911-87657933 TAATGTCAGTGACCTGAGGTGGG + Intronic
977193272 4:94026823-94026845 GTGTGGCACTGACATGAAGATGG + Intergenic
978299135 4:107245939-107245961 TTGTTTCAGCAACAAGAGGAAGG - Intronic
978497887 4:109379515-109379537 TTTTTTCAGTGACATCAAGAGGG + Intergenic
979094850 4:116534684-116534706 TTGAGTCAGTGGCCTGAGGAAGG + Intergenic
979609590 4:122675021-122675043 TTGTTTCAGTTACATGATGAGGG - Intergenic
979633683 4:122932530-122932552 TTCTGTCAGTGACCAGTGGAGGG - Intronic
980088333 4:128415813-128415835 CTGTGACAGTGCAATGAGGAAGG + Intergenic
981571917 4:146160719-146160741 TTGTGTCAGTGGGCTGGGGAAGG + Intergenic
983027707 4:162757738-162757760 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
986518314 5:8586648-8586670 TAGTGTCTGTGGCCTGAGGATGG - Intergenic
986671039 5:10142827-10142849 TTGAGTCAGTGGTCTGAGGAAGG + Intergenic
986763040 5:10897356-10897378 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
987668705 5:20980760-20980782 TTGTGTCAGTGGACTGGGGAAGG - Intergenic
987680155 5:21125200-21125222 TTGAGTCAGTGACCTGAGAAAGG + Intergenic
987906404 5:24083217-24083239 TTGAGTCAGTGAGCTGGGGAAGG + Intronic
989045762 5:37271866-37271888 TTGAGTCAGTGGACTGAGGAAGG - Intergenic
989233353 5:39114204-39114226 TTTTTTCAGTGACAGGAGGTGGG + Intronic
989486783 5:41999835-41999857 TTGAGTCAGTGGGATGGGGAAGG - Intergenic
989999946 5:50880872-50880894 TTGTATCCATGAGATGAGGATGG + Intergenic
993413027 5:87595432-87595454 TTGAGTCAGTGTTCTGAGGAAGG - Intergenic
993873482 5:93278694-93278716 AAATGTCAGTCACATGAGGAGGG + Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
996653329 5:125909440-125909462 TTGTCTCAGAGACAGAAGGATGG - Intergenic
997823042 5:137083170-137083192 CTGTGGCAATGACATGATGAGGG - Intronic
998413861 5:141931083-141931105 ATGTGTTAGTGACTTGAGCAAGG + Intronic
998644047 5:144042550-144042572 TTATGACAGGGACAAGAGGAAGG - Intergenic
1000967423 5:167674961-167674983 TTGAGACAGTGAAATGAAGAAGG - Intronic
1003255221 6:4469405-4469427 TTTTGTCTGTAACAAGAGGACGG - Intergenic
1004737031 6:18417351-18417373 TTGTGATACTGTCATGAGGATGG + Intronic
1007330303 6:41101631-41101653 CTGTGTCAGGGATATGAAGATGG + Intergenic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1008820696 6:55627600-55627622 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1009555320 6:65156642-65156664 TTAGGACTGTGACATGAGGATGG + Intronic
1011150348 6:84265559-84265581 AGGTGGCATTGACATGAGGAAGG + Intergenic
1011278266 6:85650915-85650937 TAGAATCAGTGTCATGAGGAGGG + Intergenic
1012015674 6:93846957-93846979 TTGTGTCAGTGGGCTGGGGAAGG - Intergenic
1013404992 6:109835225-109835247 TTGAGTGAGTGCCCTGAGGATGG + Intergenic
1014417298 6:121197866-121197888 TTGAGTCAGTGAGCTGAGGAAGG + Intronic
1014908456 6:127059678-127059700 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
1015002022 6:128229292-128229314 GGTTGTCAGTGACATAAGGAAGG - Intronic
1016330651 6:142948706-142948728 TTGTTTCAGAGTCATGAGGATGG + Intergenic
1016903813 6:149129425-149129447 TTGAGTCAGTGAGCTGGGGAAGG - Intergenic
1017427078 6:154333266-154333288 TTGAGTCAGTGAGCTGGGGAAGG + Intronic
1017461602 6:154656190-154656212 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1017528659 6:155266066-155266088 TTGAGTCAGTGAGGTGGGGAAGG - Intronic
1017680541 6:156859391-156859413 TGGTGCCAGTGCCATTAGGATGG + Intronic
1018226437 6:161633950-161633972 GTGTGTACGTCACATGAGGAGGG + Intronic
1018318571 6:162582957-162582979 TTGTGACAGTGATAGGAGGTAGG + Intronic
1018795121 6:167179629-167179651 TTCTGGCAGTAACGTGAGGAAGG - Intronic
1018821197 6:167375433-167375455 TTCTGGCAGTAACGTGAGGAAGG + Intronic
1018885192 6:167929511-167929533 CTGTGTGAGTGACCTGAGGAGGG - Intronic
1018892994 6:167995906-167995928 TTGGCTAAGTGACATGTGGAGGG + Intergenic
1021247698 7:18284008-18284030 TTGTACAAGTGACATGAGGCAGG - Intronic
1021455697 7:20827490-20827512 TGGTGTGGGTGACATGGGGATGG + Intergenic
1022876246 7:34533644-34533666 ATCTGTCAGGGACAAGAGGATGG - Intergenic
1023482557 7:40649946-40649968 TTGTGTCAGGAACCTGAGCATGG + Intronic
1024458147 7:49632116-49632138 TTGTCTCAGTGACCTCAGGCAGG - Intergenic
1030998993 7:116393026-116393048 TTGTGTCAGGGATCTGAGGAGGG - Intronic
1031512270 7:122665302-122665324 TTGTGTGAGTGACCTTAAGAGGG - Intronic
1031639458 7:124143666-124143688 TTGTGGCAGTGTCATGAGATTGG - Intergenic
1032479869 7:132237614-132237636 TTATGTCCGTGACCTGAGGAAGG - Intronic
1033289732 7:140073248-140073270 TTGAGTCAGTGGCATGGGAAAGG - Intergenic
1034422714 7:150997816-150997838 ATGTGTCAGTGACAGGGGCAGGG - Intronic
1035650583 8:1261004-1261026 GTGTGACAGTGGCGTGAGGAGGG + Intergenic
1038430740 8:27497456-27497478 TTGTGTGAGGGACATGACTAAGG + Intronic
1038665377 8:29532768-29532790 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1039257026 8:35730817-35730839 TTATAACAGTGACATAAGGAAGG - Intronic
1040737796 8:50531728-50531750 TTGTGTGAGGGACACGTGGAGGG - Intronic
1041552133 8:59115014-59115036 TTTTATCATTGAAATGAGGAAGG - Intronic
1041588010 8:59544423-59544445 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1041588878 8:59552620-59552642 TTGGGGGAGGGACATGAGGAGGG - Intergenic
1042374157 8:68029643-68029665 TTGTGTTAGTTACGTGATGATGG + Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043258311 8:78162606-78162628 TTGAGTCAGTGATCTGAGAAAGG + Intergenic
1047144242 8:122178980-122179002 TGATGACAGTGACATGAGAAGGG - Intergenic
1049279382 8:141736648-141736670 GGGTGGCAGTGGCATGAGGAGGG - Intergenic
1050879838 9:10685383-10685405 GTGTGTCACTGACATGTGTAGGG + Intergenic
1051489558 9:17646530-17646552 TGGTGTCAGTGACCTTTGGATGG + Intronic
1053174088 9:35909900-35909922 TGGGGGCAGGGACATGAGGAGGG - Intergenic
1054973927 9:71120967-71120989 TGGTGTCAGAGACAAGAGGCTGG - Intronic
1055103409 9:72488166-72488188 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
1055268412 9:74526612-74526634 TTGTGCCAGAAACTTGAGGAAGG + Intronic
1056313931 9:85370476-85370498 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1056486235 9:87060726-87060748 TTGGGAAATTGACATGAGGAAGG - Intergenic
1056525695 9:87441029-87441051 ATGAGTCAGTGAACTGAGGAGGG - Intergenic
1058561405 9:106232946-106232968 TTTTGTCAGTGATATGTGAATGG + Intergenic
1059453751 9:114387103-114387125 ATGTGTCAGGGAGATGGGGAAGG + Intronic
1061384985 9:130284515-130284537 GTTTGTCGGCGACATGAGGATGG - Intergenic
1185992088 X:4902561-4902583 TTGTTTCAGGGACCTGGGGAAGG - Intergenic
1186164786 X:6815036-6815058 TTGTTTCAGTGACAACACGACGG + Intergenic
1186497503 X:10023428-10023450 TTGTGTCAGAGACATTGTGAAGG + Intronic
1187521644 X:20019565-20019587 TTGTGTCAGTGACATGAGGAAGG - Intronic
1188209011 X:27396211-27396233 TTGTGACAGTGACATGATTTTGG - Intergenic
1189662444 X:43316042-43316064 TGGTATCAGTCACATGAGGAAGG + Intergenic
1191916498 X:66207087-66207109 TTCTGTCTGTGACATGAAGCTGG + Intronic
1193756332 X:85413553-85413575 TTATGCCAGGGACATAAGGATGG - Intergenic
1194161425 X:90457615-90457637 TTGAGTCAGTGAACTGAGGGAGG - Intergenic
1194955942 X:100180734-100180756 TTGAGTCAGTGAGCTGGGGAAGG + Intergenic
1195993922 X:110712444-110712466 TGGTGTCAGAGAAATGAGGCTGG + Intronic
1197291960 X:124669233-124669255 TTGTGTCAATTACTTGAGGTTGG + Intronic
1197918585 X:131563192-131563214 TTGTATTAATGACATAAGGAAGG - Intergenic
1199575115 X:149306522-149306544 TGGTTTCAGTGTGATGAGGATGG - Intergenic
1200507714 Y:4035344-4035366 TTGAGTCAGTGAACTGAGGGAGG - Intergenic
1201316525 Y:12652733-12652755 GTGTGGCAGTGGCATAAGGATGG - Intergenic
1201463758 Y:14257153-14257175 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic