ID: 1187522135

View in Genome Browser
Species Human (GRCh38)
Location X:20023105-20023127
Sequence CTTCCATACTTTCTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187522135_1187522138 13 Left 1187522135 X:20023105-20023127 CCTTGTTCCAGAAAGTATGGAAG 0: 1
1: 0
2: 3
3: 35
4: 252
Right 1187522138 X:20023141-20023163 GCTGCAGTTAGCTTCAGAAACGG 0: 1
1: 0
2: 0
3: 21
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187522135 Original CRISPR CTTCCATACTTTCTGGAACA AGG (reversed) Intronic
902051372 1:13566086-13566108 TTACCCTACTTTCTGCAACAGGG + Intergenic
902729646 1:18361074-18361096 CTTCCATCCTTTCTGGAAGTTGG - Intronic
904472450 1:30744433-30744455 CTTACATACTCCCAGGAACAGGG - Intronic
904789432 1:33007557-33007579 CCTCCAGCCTTTCTGGAATACGG + Intergenic
907766504 1:57417649-57417671 CTTCCAAACATTTTTGAACATGG + Intronic
907893132 1:58655512-58655534 CTTACATTTTTCCTGGAACAAGG - Exonic
908189016 1:61681826-61681848 CTTCCATACATTCTGTCACATGG - Intronic
910294920 1:85634873-85634895 CTTCCAATCTGTCAGGAACATGG + Intergenic
910687656 1:89933925-89933947 CTTCCTCACTTTCTCAAACAGGG - Exonic
910730757 1:90393256-90393278 CTTAGATTCTTTCTGGAATAAGG - Intergenic
910801991 1:91156317-91156339 CTCACATCCTTTCTGGAACAAGG - Intergenic
910927764 1:92413724-92413746 CCTCCATCCTTCTTGGAACATGG + Intergenic
911771063 1:101743126-101743148 CTCCCATACTTTGTTGATCATGG + Intergenic
911946168 1:104112265-104112287 CTTTTTTACTTTCTGGAACCAGG + Intergenic
912157107 1:106934437-106934459 CTTCCAACCTTTCTTTAACATGG + Intergenic
912927713 1:113928467-113928489 GTTCCATTTTATCTGGAACAGGG - Intergenic
913046464 1:115077464-115077486 CCTCCAAACTCTCTGGAATATGG - Intronic
913251371 1:116914366-116914388 CTTCCATAGTAGCTGGCACATGG - Intronic
915489523 1:156243450-156243472 CTTCAACGTTTTCTGGAACAAGG - Exonic
916695233 1:167228790-167228812 CTTACATCCTTTCTGGAGCAAGG + Intronic
916820318 1:168392160-168392182 CTACCTTAGTTCCTGGAACAGGG - Intergenic
917323165 1:173804935-173804957 CTTTCATAATTTCTTGAACAAGG - Intronic
917455994 1:175186534-175186556 CCTCCACACTGTCTGGAACAAGG - Intronic
918386072 1:184009350-184009372 CTTCAATCCTTTTTGGAAAAGGG + Intronic
918862900 1:189856249-189856271 CTTGCATACTTTTTGTATCAGGG + Intergenic
920180606 1:204129816-204129838 CTCCCAGACTTTGAGGAACAGGG + Intergenic
921816964 1:219575103-219575125 CTTCCATAATTCCTGAAACTAGG + Intergenic
922080393 1:222290200-222290222 TTTGCATGCTTTCTGCAACAGGG + Intergenic
923173439 1:231439090-231439112 CTTGCAAATTTTCTGGAACTTGG + Intergenic
924473818 1:244366521-244366543 CTTCTGTAGTTTCTGGAAGAAGG - Intronic
924659219 1:246001425-246001447 CTTCCATAGTACCTGGAGCAAGG - Intronic
924733626 1:246734689-246734711 CTTCCAGCCTTTGAGGAACAAGG - Intronic
924832051 1:247606449-247606471 CATCTATACTTTAAGGAACAAGG + Exonic
1064988837 10:21238032-21238054 CTACCAGAATTCCTGGAACACGG + Intergenic
1065127582 10:22588594-22588616 CTTAAATCCTTTCTGGAATAAGG + Intronic
1066081928 10:31939466-31939488 CTTCCCTAATATCGGGAACAAGG + Intergenic
1067483033 10:46617788-46617810 TTTTTATACTTTCTGGAAAATGG - Intergenic
1067611725 10:47723873-47723895 TTTTTATACTTTCTGGAAAATGG + Intergenic
1068590427 10:58847454-58847476 GCTCCATACTTTCTAGGACATGG - Intergenic
1068891655 10:62154600-62154622 CTTTAAAACTTTCTGGAACTGGG - Intergenic
1069600410 10:69702175-69702197 CTTCCTTACTTTCTGGCACAAGG + Intergenic
1069668329 10:70180235-70180257 CTTCTATACTTTTTGGCACAAGG - Intergenic
1070521157 10:77254789-77254811 CTTCTATAGTTTCAGGGACAAGG + Intronic
1070560966 10:77566257-77566279 CTTCCATGTTTCCTGGACCAAGG - Intronic
1071627145 10:87184111-87184133 TTTTTATACTTTCTGGAAAATGG + Intronic
1072530909 10:96318073-96318095 CTTCCATCTTTTCTGGACCTTGG + Intronic
1075418956 10:122286766-122286788 CCTACATTCTTTCTGGAATAAGG - Intronic
1075699033 10:124456644-124456666 CTTCCTTCCTTTCTGAGACAGGG - Intergenic
1077504725 11:2924672-2924694 CTTGGAAACTTTCTGGAGCAGGG + Intronic
1078905858 11:15687165-15687187 TTTCAATACTTTTGGGAACAAGG - Intergenic
1080719176 11:34832578-34832600 CCTCCCCACTTCCTGGAACATGG - Intergenic
1081353754 11:42088110-42088132 CTTGCCTAATTTCTGGAAAAGGG + Intergenic
1083074963 11:60027394-60027416 CCCCCATACTTCCTGGAACGGGG + Intergenic
1084356917 11:68645213-68645235 TTTACACACTTTCTGGAAAATGG - Intergenic
1085852859 11:80141831-80141853 CTTGAATCCTTTCTGGAACAAGG + Intergenic
1087923679 11:103895420-103895442 CTTCCATCCTCTCTGTAATAGGG + Intergenic
1089597817 11:119592847-119592869 CTCCCATTATTTCTGGCACAGGG - Intergenic
1091918359 12:4285183-4285205 CCTCCATGCTGCCTGGAACAGGG + Intronic
1091960656 12:4691474-4691496 CTTAAATCCTTTCTGGAACAAGG - Exonic
1092701840 12:11240575-11240597 CTTGCATATTCTCTGGCACATGG - Intergenic
1093303980 12:17489419-17489441 CAACCATACTTTCTCCAACAAGG - Intergenic
1094820131 12:34218245-34218267 CTCTCTTACTTTCTGAAACAGGG + Intergenic
1095094611 12:38139243-38139265 CTCTCTTACTTTCTGAAACAGGG - Intergenic
1095629739 12:44361529-44361551 CTTGCACAGTTTCTGGCACATGG + Intronic
1097365891 12:58711948-58711970 CTTCCAAACTTCGTGGAACATGG + Intronic
1097962283 12:65544448-65544470 CCTCCATCCTTTCTAGACCAAGG + Intergenic
1097973978 12:65665081-65665103 CTTCCAAACATTCTGGAAGTGGG - Intergenic
1099226262 12:79973008-79973030 CTTCCTTGCTTTCTGGCCCATGG - Intergenic
1101072312 12:101088550-101088572 ATTCCCTAGTGTCTGGAACAGGG + Intronic
1101483734 12:105129892-105129914 GTTACATGCTTTATGGAACATGG - Intronic
1102411243 12:112721124-112721146 CTAGCATAGTTTCTGGCACACGG + Intronic
1102971733 12:117173396-117173418 CTTAAATACTTTCTGGAAGAAGG - Intronic
1104611934 12:130235858-130235880 CTCCCCTATGTTCTGGAACAAGG + Intergenic
1105042103 12:132968621-132968643 CTTCCAGTCATTGTGGAACATGG + Intergenic
1105265609 13:18811298-18811320 CTTTTTTACTTTCTGGCACAAGG - Intergenic
1105482093 13:20787371-20787393 CTTCCATTCTTTCGGGGGCAAGG - Intronic
1106099482 13:26682074-26682096 CTTCCAAACTAACTGGACCATGG - Intronic
1106439849 13:29756715-29756737 CTTGCATATTTCCTGGCACATGG + Intergenic
1106473231 13:30076387-30076409 CTTCCTTGGTTTCTGGAGCAGGG - Intergenic
1106617988 13:31348060-31348082 CTTCTGTGCTTTCTAGAACAAGG + Intergenic
1109599595 13:64607320-64607342 TTTAAATTCTTTCTGGAACAAGG - Intergenic
1109700065 13:66012691-66012713 CTGCCATGCTATCTGCAACATGG - Intergenic
1109710502 13:66152659-66152681 CTTCCTTCCTTCCTGGACCAAGG - Intergenic
1111316785 13:86572840-86572862 CTTCCATTATTTCTTGAATAGGG - Intergenic
1111604138 13:90515904-90515926 CTTACAAACTTTCTGAAAAATGG + Intergenic
1114775018 14:25472148-25472170 CTTTCTTCCTCTCTGGAACAGGG + Intergenic
1114799162 14:25752831-25752853 TTTTAATCCTTTCTGGAACAAGG - Intergenic
1116629831 14:47316174-47316196 TTACCATACTTTCTGGCTCATGG + Intronic
1117254101 14:53961139-53961161 CCTTGATACTTTCTGGAATATGG + Intergenic
1120138550 14:80900570-80900592 GTACCATACTTTCTTGTACATGG - Intronic
1120634503 14:86934650-86934672 CTTCCATAATTTCTGTGACGGGG + Intergenic
1120859682 14:89243773-89243795 CTTCCATAGGTTGTGGAAAATGG - Intronic
1121073536 14:91047175-91047197 CTTACATCTTTTCTGGACCAAGG - Intronic
1122666270 14:103332830-103332852 CTCCCATTCTTTCTGAAACTTGG - Intergenic
1123814027 15:23958248-23958270 CTTCCACTCTTCCAGGAACATGG - Intergenic
1125136179 15:36345883-36345905 CATCCTTACATTATGGAACATGG - Intergenic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1127220078 15:56870500-56870522 CTTCCCCACTTACTGCAACATGG - Intronic
1127533621 15:59869057-59869079 CTGCCACACTTTCTTGAGCATGG - Intergenic
1128864361 15:71102930-71102952 TTCCCTTACTTTATGGAACATGG + Intronic
1128864502 15:71104095-71104117 ATTCCATCTTTTCTGGAATAAGG + Intronic
1128888003 15:71305884-71305906 CTTCCAGATTTTCTGGGACCTGG + Intronic
1129634435 15:77300025-77300047 CTACTTTACTTTCTGGTACAGGG + Intronic
1130156565 15:81355515-81355537 CTTCCATAGATCCTGTAACAAGG - Intronic
1130702383 15:86197679-86197701 CTTCCTCACTTTTTGCAACATGG - Intronic
1130875993 15:88015077-88015099 TTTCTCTTCTTTCTGGAACAGGG + Intronic
1131335352 15:91543803-91543825 TTTCCATATTTTCTGGATCGAGG + Intergenic
1134204988 16:12229897-12229919 CTTTCATTCTTTCTAGGACAGGG + Intronic
1134324773 16:13197197-13197219 TTTTCCTACTGTCTGGAACACGG + Intronic
1135138200 16:19900197-19900219 CTTCCATTCTTTTTGGAATAGGG - Intergenic
1137312482 16:47278498-47278520 CTTGCATACTGCCTGGACCATGG - Intronic
1137499630 16:49000590-49000612 CTTCCATACATCCTAGAACAGGG + Intergenic
1139281285 16:65773030-65773052 CTTAAATACTTTCTGAAACAAGG - Intergenic
1139314455 16:66056496-66056518 CCCCCATACTTTGTGGAACTAGG - Intergenic
1140033910 16:71358848-71358870 CTTCCATATTTCCAGGAACTGGG - Exonic
1140131934 16:72170387-72170409 CTTAAATCCTTTCTGGAACAAGG + Intronic
1140951520 16:79822973-79822995 CTTCCATCCTCTTTGCAACAGGG - Intergenic
1147911607 17:43859392-43859414 CCTCCATGCTTGCTGGAACAGGG + Intronic
1149791523 17:59481902-59481924 CTGAAATCCTTTCTGGAACAAGG - Intergenic
1151129684 17:71883411-71883433 TTTCAATCCTTTCTGGAATAAGG - Intergenic
1151310910 17:73291914-73291936 CTTCCGTAGTCTCAGGAACAGGG - Intronic
1154319935 18:13340338-13340360 CTTCCATACTGTCTTCCACAGGG + Intronic
1155947703 18:31875060-31875082 CTTAAATTCTTTCTGGAAAAAGG + Intronic
1156062376 18:33095988-33096010 CTTCCACACTTTGGGGATCATGG - Intronic
1156782354 18:40866207-40866229 CTTGCATATTTCCTGGAATAGGG + Intergenic
1158318419 18:56237404-56237426 CTTCCACACTTTTTGGCTCATGG - Intergenic
1158456631 18:57614049-57614071 CTTCAATACCTTCCAGAACATGG + Intronic
1162962076 19:14134276-14134298 GTTAAATCCTTTCTGGAACAAGG - Intronic
1164502162 19:28829190-28829212 CTTGGATAATTTCTGGGACATGG - Intergenic
1165693936 19:37885945-37885967 CTTCCATTCGTTCTAGGACATGG + Exonic
1167369160 19:49070661-49070683 CTTCCCTACTTTGTGGCACTGGG - Exonic
925911688 2:8577923-8577945 CTTCCCTGCTTCCTGGTACATGG + Intergenic
926996823 2:18744582-18744604 CTTCCACACTTGCAGAAACAGGG + Intergenic
927607424 2:24499746-24499768 CTTAAATCCTTTTTGGAACATGG - Intronic
929088763 2:38194282-38194304 CTATCATACTTTGTTGAACATGG - Intergenic
929586861 2:43121784-43121806 CTTCCATCCCATCTGGAACCAGG - Intergenic
931581092 2:63775672-63775694 CTTAGAGTCTTTCTGGAACAAGG + Intronic
932590697 2:73065106-73065128 CTTCCCTTCTTTCTGAGACAGGG + Intronic
932668572 2:73717820-73717842 CTTCCAGCCTTGCAGGAACAGGG + Intergenic
933122622 2:78560242-78560264 CTGACTTACTTTCTGGAAAATGG - Intergenic
933436940 2:82260576-82260598 CTCCCATCCTTTCTGGTCCAAGG - Intergenic
934693148 2:96377479-96377501 CTTCCATAGTTTCTGAAGAAAGG + Intergenic
935242212 2:101188796-101188818 CTTCCATGGATTCTGGAGCAGGG - Intronic
935765416 2:106362272-106362294 CACTCATACTTTCTGGCACAAGG + Intergenic
938664032 2:133515615-133515637 CTTGCATTCTTTCTGGCATATGG - Intronic
940771798 2:157846628-157846650 CTTAAATTGTTTCTGGAACAAGG - Intronic
940938608 2:159529180-159529202 CTTCCAAACTTACTTGACCATGG + Intronic
942067694 2:172287132-172287154 CTTCCATTGTTTCTATAACAAGG + Intergenic
942431037 2:175911813-175911835 CTTACATCCTGTGTGGAACAAGG - Intergenic
942646779 2:178120123-178120145 CTTCTTTGCTTTCTGGAAGATGG - Intronic
944864744 2:203849419-203849441 CTTCCATATCATCTGGAGCATGG - Intergenic
945111704 2:206366337-206366359 CTTCCATCCTTTTTGAGACAGGG + Intergenic
946846700 2:223865417-223865439 CTTCCTTGCTTTCTAGCACAGGG - Intronic
947510117 2:230744662-230744684 CTTAAATTCTTTCTGGAACAAGG - Intronic
948328524 2:237146236-237146258 CTTCTATACTTTCAGGTATACGG - Intergenic
1169484119 20:6012323-6012345 CTTCCACTCTTGCTGGATCATGG - Intronic
1170488056 20:16840158-16840180 CTTCCAATATTTCTGAAACAAGG + Intergenic
1170561021 20:17558683-17558705 CTTACATACTTTCTCCAGCATGG + Intronic
1172792661 20:37516819-37516841 CTACCATGCTTTCTAGAAGAAGG + Intronic
1172903973 20:38355381-38355403 CTCCAGTACTTTCTGGAACTTGG - Exonic
1174512381 20:51063626-51063648 CTTCCTTACATTCTGGCACAAGG + Intergenic
1175954485 20:62602093-62602115 CCTCCTTGCTTTCTGGAACCAGG + Intergenic
1177200248 21:17945733-17945755 CTTCCATGCTTTCTGCACCTGGG - Intronic
1178303068 21:31468878-31468900 CTTCCACACTTTCTGGCCCTGGG + Intronic
1181577710 22:23805933-23805955 CTTGCATCCTTTCTGGAACAGGG - Intronic
1183754271 22:39745170-39745192 CTTCCAAGCTTTCTTAAACATGG + Intronic
1183859736 22:40661257-40661279 CTTCCAGGACTTCTGGAACAAGG - Intergenic
1184371346 22:44084117-44084139 CCTCCATCCTTTCTGGGTCAAGG + Intronic
1185414010 22:50699959-50699981 CTCCCATACTGTCTGAACCAGGG - Intergenic
949098013 3:109350-109372 CTTCTTTATTTTCTGGAAAATGG + Intergenic
951092553 3:18591494-18591516 ATGTCATACTTTCTGGAAAAAGG - Intergenic
954894241 3:53962551-53962573 CTTAAATCCTTTTTGGAACAAGG - Intergenic
955076931 3:55622730-55622752 CTTTAATCCTTTCTGGACCAAGG - Intronic
955412354 3:58663927-58663949 ATTCCATACTTTGTGGAATGTGG + Intronic
955977637 3:64493358-64493380 TTTGCATCCTTTCTGGAAGAGGG + Intergenic
957586259 3:82136347-82136369 CTCACATATTTTATGGAACAAGG + Intergenic
959156692 3:102675003-102675025 CTTCAACTCTTTCTGGAAAAGGG + Intergenic
959737757 3:109680004-109680026 TTTCCACACTTTCTGGATGAAGG - Intergenic
959846020 3:111034822-111034844 CTACCATGCTTTATGGAAGAGGG + Intergenic
961020136 3:123498395-123498417 CTTCCCTACTCTCTGAAAGAGGG + Intronic
961310237 3:125993220-125993242 GTTCCTTACTTTCTACAACAAGG - Intergenic
962895905 3:139714607-139714629 CTTGCATATTTCCTGAAACATGG + Intergenic
963402689 3:144821124-144821146 ATTAAATATTTTCTGGAACAAGG - Intergenic
963753200 3:149204072-149204094 CTGCCATATTTTCTAGAACATGG - Intronic
963810935 3:149775717-149775739 CATTCATCCTTTCTGAAACAAGG - Intronic
966462646 3:180194487-180194509 CTGCCATACTTTCAGTAGCAAGG + Intergenic
966804458 3:183795887-183795909 CTTAAATACTTTCTAGAGCAAGG - Intronic
967019835 3:185513019-185513041 CTTACTAACTTTCTGGCACACGG - Intronic
969175378 4:5394990-5395012 CTGCACTCCTTTCTGGAACATGG + Intronic
969541811 4:7796282-7796304 TTTCCTTACTTTGTGGCACAAGG - Intronic
970920187 4:21385011-21385033 CTTCTACACTTTATGGAACAGGG + Intronic
971948406 4:33311476-33311498 CTTCCAATCTTTCTGTAACTAGG + Intergenic
972472118 4:39416052-39416074 TTTAAATCCTTTCTGGAACAAGG - Intronic
975176381 4:71294121-71294143 CTTCAATTCTTTCTGGAATGAGG + Intronic
975452547 4:74546203-74546225 CTTCTATTCTATCTGAAACATGG - Intergenic
976494907 4:85716870-85716892 CTTCCATGCTAGCTGCAACATGG - Intronic
978103705 4:104875448-104875470 ATTCCAGAATCTCTGGAACATGG + Intergenic
980081203 4:128346010-128346032 CATCCATAGTTCCTGGAACAGGG + Intergenic
980714954 4:136616309-136616331 TTTCCCTACTTTTTGCAACAGGG + Intergenic
982467517 4:155748806-155748828 TTTCCTTACTTCCTGGACCATGG + Intergenic
984166720 4:176311582-176311604 CTTCCTTATTTTCTCAAACAGGG - Intergenic
989767287 5:45102689-45102711 TTTCCGTACTTTCAGCAACAAGG - Intergenic
990419610 5:55618461-55618483 ATTAGATCCTTTCTGGAACAAGG + Intergenic
990928016 5:61051731-61051753 CTTACATCCTTTCTGGAAGAAGG - Intronic
991321902 5:65383527-65383549 CTTCCAGACATACTGGGACAGGG + Intronic
991499357 5:67261277-67261299 CTTACATACATTATGGTACAGGG + Intergenic
993027630 5:82664605-82664627 CTTCCATACGTACTGCAACTAGG - Intergenic
993215363 5:85016018-85016040 CTTCCATGTTTACTCGAACAAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
998436993 5:142118878-142118900 CTTCCATACTTTTTGGCACTAGG + Intronic
998661005 5:144237624-144237646 TTTCCAGTTTTTCTGGAACAGGG + Intronic
998948758 5:147370113-147370135 CTGCCATACTCTGTGGAACCAGG + Intronic
1001178368 5:169494545-169494567 AATCCATCCTTTCAGGAACAAGG - Intergenic
1001603911 5:172946576-172946598 TCACCATACCTTCTGGAACATGG - Intronic
1002297783 5:178240931-178240953 CCTCCCTACTTTCTAGAAAAAGG + Intronic
1003894641 6:10595609-10595631 CTTAAGTCCTTTCTGGAACATGG - Intronic
1004226831 6:13792860-13792882 TTTCCATACTGTATGGAACCTGG - Intronic
1004358647 6:14951750-14951772 CTTCCATTCTTTCTGGATCCTGG - Intergenic
1005361292 6:25033399-25033421 CTTCTTTATTTTCTGGCACAAGG + Intronic
1006641668 6:35492511-35492533 CTTCCCTCCTTCCTGGAACAGGG + Intronic
1008639968 6:53452312-53452334 CTTCCATGCTTTCATAAACATGG + Intergenic
1008661868 6:53677015-53677037 CTTCCAAACTTTCTCCACCATGG - Intergenic
1008904243 6:56658738-56658760 GTGCCTTACTTCCTGGAACATGG - Intronic
1010746370 6:79566637-79566659 TTTCCATAATATCTAGAACAGGG + Intergenic
1011120753 6:83949617-83949639 ACTCCATCCTTTGTGGAACAAGG + Intronic
1011178335 6:84588993-84589015 CTTCCATATTGTCTGGAAAATGG - Intergenic
1011283670 6:85702272-85702294 CTTCCTTCCTTTTTGAAACAGGG + Intergenic
1012053533 6:94374709-94374731 CTTCCATTCTTTATGGGGCACGG + Intergenic
1012110944 6:95232874-95232896 CTTACATAATTTCTCTAACAAGG - Intergenic
1012695296 6:102374118-102374140 TTTTCTTACTTTCTGAAACAAGG + Intergenic
1013244652 6:108275033-108275055 CTTCCATACATTGCTGAACAGGG - Intergenic
1013927390 6:115489580-115489602 CTTCCTTACTTTTGGGAATAGGG + Intergenic
1015368753 6:132426498-132426520 CTTCCCTAATTTCAGAAACAAGG - Intergenic
1015947674 6:138519977-138519999 CTTCAATCCTTTCTGAAACAAGG + Intronic
1016053584 6:139555286-139555308 CTTAAATCCTTTCTGGAACAAGG - Intergenic
1017525634 6:155239504-155239526 CTTCCACAGTTGCTGGAGCAGGG - Intronic
1017791418 6:157802900-157802922 TTTCCCTATATTCTGGAACATGG - Intronic
1021001099 7:15331345-15331367 CAGCCATAATTTCTGGAACAGGG + Intronic
1022375959 7:29811327-29811349 CTTGAACACTTTATGGAACACGG - Intronic
1023319776 7:38981971-38981993 ATTAAATACTTTTTGGAACAAGG - Intronic
1024435036 7:49342168-49342190 ATTCCAAACTTTCTGGAAAAGGG - Intergenic
1024724209 7:52174421-52174443 CTATCATACTTTCTTGATCAGGG + Intergenic
1026268216 7:68813749-68813771 CTTCCATACTTTCTTTACCTTGG + Intergenic
1026676478 7:72432694-72432716 CTTGCATCCTTTCTGGAACAAGG + Intronic
1028703135 7:93806607-93806629 CTCTGACACTTTCTGGAACAGGG - Intronic
1029059693 7:97784622-97784644 CTTGTATGCTTTCTGGAGCATGG + Intergenic
1030024027 7:105304545-105304567 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030200106 7:106894209-106894231 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030682399 7:112447926-112447948 CATACATACATTCTGGATCAAGG - Intronic
1030959876 7:115904606-115904628 CTCATATACTTTCTGGAAAATGG + Intergenic
1033397010 7:140984861-140984883 TTTCCTTACTTTCTGACACAAGG - Intergenic
1033534151 7:142296793-142296815 TTTCCTTACTTTATGGCACAAGG - Intergenic
1034257575 7:149733077-149733099 CTTCCTTCCTTTCTGGAAGCTGG + Intronic
1037241036 8:16777900-16777922 CTTCCAGAATTTCTCGAACTGGG - Intergenic
1038511739 8:28143838-28143860 CTTAAATCCTTTCTGGAACAAGG + Intronic
1039899892 8:41744026-41744048 TTTTCCTACTTTCTGGCACAAGG - Intronic
1041329622 8:56710660-56710682 CTTTCCTGCTTTCTGGAAAAGGG + Intergenic
1043551326 8:81376206-81376228 CATCCATCCCTTCTGGAATAGGG - Intergenic
1044745315 8:95365296-95365318 CCTAAATTCTTTCTGGAACAAGG - Intergenic
1045049838 8:98313298-98313320 CTTAAATACTTTCTCAAACAAGG + Intergenic
1048653080 8:136502690-136502712 CATCCATGCTTCCTGGTACAAGG - Intergenic
1050249329 9:3727957-3727979 CTTCCCCAGTTCCTGGAACATGG - Intergenic
1050360225 9:4823121-4823143 CTTCCAGGCATTCTGGAGCAGGG + Intronic
1051887504 9:21909736-21909758 ATGCCATACTATCTGGCACATGG - Intronic
1052764642 9:32628860-32628882 CTTAAATCCTTCCTGGAACAAGG + Intergenic
1052876647 9:33573110-33573132 CTTTTTTACTTTCTGGCACAAGG + Intergenic
1053136240 9:35651821-35651843 TTTTCAGAATTTCTGGAACATGG - Intergenic
1053499352 9:38571234-38571256 CTTTTTTACTTTCTGGCACAAGG - Intronic
1054847517 9:69812195-69812217 TTTACAAACTTTCTGGAAAAGGG + Intergenic
1057044791 9:91877303-91877325 CATCCATACTTCCTGAAAGAAGG + Intronic
1061105751 9:128529075-128529097 CTGAAATTCTTTCTGGAACAGGG + Intronic
1061796808 9:133090385-133090407 CTTCCAGGCTTCCTGGAACTGGG - Intergenic
1186553353 X:10530511-10530533 CTTACATACTTTATGCAAAAAGG + Intronic
1187522135 X:20023105-20023127 CTTCCATACTTTCTGGAACAAGG - Intronic
1187947177 X:24437642-24437664 CTTAGATCCTTTCTGGAACAAGG - Intergenic
1188274586 X:28184097-28184119 CTGCTAAACTTTCTGGAACAAGG - Intergenic
1190376664 X:49795045-49795067 CATCCTTACATCCTGGAACAAGG - Intergenic
1190783124 X:53618059-53618081 CTACCAAAGCTTCTGGAACATGG + Intronic
1190997219 X:55621648-55621670 ATTACATACTTCTTGGAACATGG + Intergenic
1191869591 X:65734768-65734790 CTTAAATCCTTTTTGGAACAAGG - Intronic
1192748954 X:73968195-73968217 ATTGCTTACTTTCTGGTACAAGG + Intergenic
1193264125 X:79447830-79447852 TTGCCAAATTTTCTGGAACATGG - Intergenic
1194859283 X:98976135-98976157 CTTGCATACTTTAAGTAACATGG - Intergenic
1196760135 X:119193522-119193544 CATGCATAGTTTCTGGCACATGG - Intergenic
1196934369 X:120715071-120715093 CTTCCATGCTTTCTGAGACCAGG + Intergenic
1197963343 X:132029592-132029614 TTTCCATACTTTCTGTTATATGG + Intergenic
1198156526 X:133966131-133966153 CTAACAGACTTTCTGGAATATGG - Intronic
1199339590 X:146661195-146661217 ATTCCATACCTTCTGGCACAAGG - Intergenic
1199857198 X:151769221-151769243 CTTCCATACTGTATCGAATAGGG - Intergenic
1201766604 Y:17578879-17578901 CTCTCTTACTTTCTGAAACAGGG + Intergenic
1201834948 Y:18327105-18327127 CTCTCTTACTTTCTGAAACAGGG - Intergenic