ID: 1187523727

View in Genome Browser
Species Human (GRCh38)
Location X:20035754-20035776
Sequence CACACCCACCTAATTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 13, 2: 54, 3: 189, 4: 525}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187523727_1187523735 18 Left 1187523727 X:20035754-20035776 CCACAAAAAATTAGGTGGGTGTG 0: 1
1: 13
2: 54
3: 189
4: 525
Right 1187523735 X:20035795-20035817 CCCAGCTATTTGGGAGGCTGAGG 0: 3819
1: 100196
2: 304725
3: 461060
4: 384717
1187523727_1187523737 22 Left 1187523727 X:20035754-20035776 CCACAAAAAATTAGGTGGGTGTG 0: 1
1: 13
2: 54
3: 189
4: 525
Right 1187523737 X:20035799-20035821 GCTATTTGGGAGGCTGAGGCAGG 0: 2926
1: 83691
2: 251726
3: 405712
4: 379084
1187523727_1187523731 9 Left 1187523727 X:20035754-20035776 CCACAAAAAATTAGGTGGGTGTG 0: 1
1: 13
2: 54
3: 189
4: 525
Right 1187523731 X:20035786-20035808 ACCAGTAGTCCCAGCTATTTGGG 0: 7
1: 763
2: 18900
3: 110376
4: 341621
1187523727_1187523733 12 Left 1187523727 X:20035754-20035776 CCACAAAAAATTAGGTGGGTGTG 0: 1
1: 13
2: 54
3: 189
4: 525
Right 1187523733 X:20035789-20035811 AGTAGTCCCAGCTATTTGGGAGG 0: 17
1: 2191
2: 50569
3: 179993
4: 559653
1187523727_1187523730 8 Left 1187523727 X:20035754-20035776 CCACAAAAAATTAGGTGGGTGTG 0: 1
1: 13
2: 54
3: 189
4: 525
Right 1187523730 X:20035785-20035807 CACCAGTAGTCCCAGCTATTTGG 0: 8
1: 1247
2: 32303
3: 110774
4: 218903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187523727 Original CRISPR CACACCCACCTAATTTTTTG TGG (reversed) Intronic
900277699 1:1842796-1842818 CACACCCAACTTTTTTTCTGAGG - Intronic
900748379 1:4377054-4377076 CACACCCACCCCCTTTTCTGTGG - Intergenic
901282934 1:8053271-8053293 CACGCCTGGCTAATTTTTTGTGG - Intergenic
901487777 1:9577289-9577311 CACACCCGGCTAATTTTTGTAGG - Intronic
901596414 1:10389010-10389032 CACGCCCAGCTAATTTTGGGGGG + Intergenic
901693480 1:10989609-10989631 CACACCTGGCTAATTTTTTTTGG - Intergenic
902029893 1:13414613-13414635 CACGCCCAGCTAATTTTTGTGGG + Intronic
902296095 1:15467933-15467955 CACACCTGGCTAATTTTTTTTGG - Intronic
902648375 1:17819849-17819871 CACACCCAGCTAATTTTCCTAGG - Intronic
903194293 1:21673340-21673362 CACACCCACCTACTCCCTTGAGG - Intergenic
903700111 1:25240728-25240750 CGCACCTGGCTAATTTTTTGGGG - Intergenic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
903881948 1:26516550-26516572 GACGCCCAGCTAATTTTTGGTGG + Intergenic
903927477 1:26840964-26840986 CACATACAGCTAATTTTTTGGGG + Intronic
904776253 1:32908813-32908835 CACACCCAGCTAATTCGTGGGGG - Intergenic
906104693 1:43284813-43284835 CACGCCCTCCTCAGTTTTTGGGG + Intronic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906412176 1:45587341-45587363 CACACCTGGCTAATTTTTTGGGG + Intronic
907182549 1:52583534-52583556 CACACCTGGCTAATTTTTTAAGG + Intergenic
907206454 1:52776060-52776082 CACGCCCGGCTAATTTTTTTGGG - Intronic
907254803 1:53170839-53170861 CACACCCAGCTAATTTTTGTGGG - Intergenic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907497821 1:54856442-54856464 CACGCCCGGCTAATTTTTTTTGG - Intronic
907507750 1:54933658-54933680 CACGCCTGGCTAATTTTTTGTGG + Intergenic
907923470 1:58934354-58934376 CACAGCTGGCTAATTTTTTGTGG + Intergenic
908084237 1:60613363-60613385 CTCACACACTTAATTTTTGGGGG + Intergenic
909710342 1:78642423-78642445 CATACCCAGCTAATTTTTGTGGG - Exonic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
910477392 1:87621719-87621741 CACACCCGGCTAATTTTTGTGGG - Intergenic
910554941 1:88521199-88521221 CACACCTGGCTAATTTTTTTTGG + Intergenic
911442444 1:97944207-97944229 CACGCCCAGCTAATTTTTGTGGG + Intergenic
911986575 1:104633056-104633078 CACAGCCAACATATTTTTTGTGG - Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
912455706 1:109795583-109795605 CACGCCCGGCTAATTTTTTTTGG + Intergenic
912767665 1:112430384-112430406 CCCACCTATCTAATTTGTTGTGG + Intronic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913525074 1:119683488-119683510 CACGCCCAGCTAACTTTTTAAGG - Intronic
914326316 1:146620292-146620314 CACACCCAACTAATTTTTGTGGG - Intergenic
914724808 1:150318629-150318651 CACGCCCGGCTAATTTTTTGTGG - Intergenic
914904535 1:151732961-151732983 CACACCCAGCTAATTTTAGTGGG - Intergenic
915042674 1:152981986-152982008 AACACACACCTAAATGTTTGTGG - Intergenic
915115560 1:153596938-153596960 CACGCCCGGCTAATTTTTGGGGG + Intergenic
915261715 1:154681620-154681642 CACGCCCGCCTAATTTTTTTTGG - Intergenic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
917421149 1:174864958-174864980 CACATCCAGCTAATTTTTGTAGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918722178 1:187866997-187867019 CACACTCACCTAATTGTTTTGGG + Intergenic
918978528 1:191524607-191524629 CACACCTCGCTAATTTTTTTTGG + Intergenic
919267934 1:195296845-195296867 CACACACACCAAGTTTTCTGGGG + Intergenic
919911825 1:202115951-202115973 CACACCCAGCTAAATTTTAGTGG + Intergenic
919998642 1:202777647-202777669 CACACTCAGCTAATTGTTTAAGG + Intronic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
920982397 1:210850352-210850374 CACGCCCAGCTACTTTTTTTTGG - Intronic
921541001 1:216415675-216415697 CACACCTGGCTAATTTTTTTAGG + Intronic
921560967 1:216657821-216657843 CTCCCCCACCTCATTTTTTATGG - Intronic
921672091 1:217936801-217936823 CACATACATATAATTTTTTGTGG - Intergenic
921996375 1:221423850-221423872 CACTCCCAACTAGTTTTATGAGG + Intergenic
922498302 1:226077970-226077992 CACGCCCAGCTAATTTTTGTGGG + Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
922708116 1:227802109-227802131 CACGCCCAGCTAACTTTTTTGGG + Intergenic
923250567 1:232176422-232176444 CACACCCAGCTAATTTTTAAAGG - Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923928547 1:238664724-238664746 CATACCCAGCTAATATTTTTTGG - Intergenic
924069491 1:240261759-240261781 CACACACAGGTAATTATTTGGGG - Intronic
924431292 1:243999139-243999161 CAGACACACCACATTTTTTGTGG - Intergenic
924763868 1:247013271-247013293 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1063144092 10:3280658-3280680 CACTCCAACCTATTGTTTTGGGG + Intergenic
1063957665 10:11281594-11281616 CACACCCAGCTAACTTTTGTAGG - Intronic
1064203611 10:13304353-13304375 CACGCTCAGCTAATTTTCTGGGG - Intergenic
1064628909 10:17289336-17289358 CCCTGCCACCTAATTTTTTGAGG + Intergenic
1064661538 10:17612763-17612785 CACGCCCGGCTAATTTTTTTTGG - Intronic
1064737627 10:18399018-18399040 CACCCACACATAATTTTGTGCGG - Intronic
1064759324 10:18602217-18602239 CACACCCAGCTAATTTTTGTGGG + Intronic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065374226 10:25020608-25020630 CACACCCAGCTAATTTTTGTAGG - Intronic
1065545485 10:26815752-26815774 CATACCCAGCTAATTTTTTTGGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1065567842 10:27032916-27032938 CACACCTGGCTAATTTTTTGTGG - Intronic
1065791107 10:29261840-29261862 CACACCCAGCTAATTTGATGAGG + Intergenic
1066207945 10:33208215-33208237 CACGCCGAGCTAATTTTTTGTGG + Intronic
1066236608 10:33490966-33490988 CACTCCCGGCTAATTTTTTATGG - Intergenic
1067379337 10:45758762-45758784 CATGCCCGGCTAATTTTTTGTGG + Intronic
1067887037 10:50099424-50099446 CATGCCCGGCTAATTTTTTGTGG + Intronic
1068173556 10:53426592-53426614 CACACCCAACTAATTTGTAAAGG + Intergenic
1068691975 10:59925884-59925906 CAGACCCACCTAAATATTTCAGG - Intergenic
1069411607 10:68159953-68159975 CTCACACACATCATTTTTTGTGG + Intronic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1072042525 10:91622284-91622306 GACACCCAGCTAATTTTTGTGGG + Intergenic
1072070497 10:91910561-91910583 AACACCCAGCTAATTTTTAGTGG + Intergenic
1072155971 10:92723955-92723977 CACACCTGGCTAATTTTTTCAGG - Intergenic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1074157150 10:110809057-110809079 CACACCAGGCTAATTTTTTTAGG - Intronic
1074297034 10:112199546-112199568 CTCACATACTTAATTTTTTGTGG - Intronic
1074846479 10:117403376-117403398 CCCACCCCCATAATCTTTTGAGG - Intergenic
1075253385 10:120903351-120903373 CACACCCAGCTAATTTTCAAGGG - Intronic
1075275349 10:121088062-121088084 CACACACAGCTATTTGTTTGAGG + Intergenic
1075703016 10:124481531-124481553 CACACCTGGCTAATTTTTTTTGG + Intronic
1075878935 10:125832963-125832985 CATACCCGGCTAATTTTTTGTGG - Intronic
1076042706 10:127264815-127264837 CGTGCCCAGCTAATTTTTTGTGG + Intronic
1076428688 10:130386276-130386298 CACACTCACTCAACTTTTTGGGG - Intergenic
1077638826 11:3862891-3862913 CACACACACATATTTTTTTGAGG + Intronic
1077739049 11:4824713-4824735 CATCTCCACCTAATTTTCTGTGG + Intronic
1077867095 11:6231625-6231647 CACACCTGGCTAATTTTTGGTGG + Intronic
1078109566 11:8381774-8381796 CACACTCACCTAAAGTTTTTGGG - Intergenic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1079291777 11:19194520-19194542 CACACCAGGGTAATTTTTTGGGG - Intronic
1079424016 11:20323304-20323326 TGCACCTAGCTAATTTTTTGTGG - Intergenic
1080191882 11:29560267-29560289 CACGCCCAGCTACTTTTTTGGGG - Intergenic
1080780923 11:35429402-35429424 CACACTCACCTAAGACTTTGAGG - Intergenic
1081116094 11:39203395-39203417 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1081163725 11:39784391-39784413 CACGCCCTGCTAATTTTTTTTGG + Intergenic
1081213454 11:40364285-40364307 CACATTTACCTAATTTTTTTTGG - Intronic
1081413015 11:42782253-42782275 CACAGCTACCCATTTTTTTGTGG - Intergenic
1081443632 11:43107981-43108003 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1081486671 11:43536036-43536058 CACGTCCAGCTAATTTTTTTTGG + Intergenic
1082950658 11:58811855-58811877 CACACACACCTCTTTTTTTAGGG - Intergenic
1083055706 11:59817265-59817287 CACACACACACAGTTTTTTGAGG - Intergenic
1083304582 11:61755801-61755823 CACACCCACCTGCTTTCTGGGGG - Intronic
1083791046 11:64986130-64986152 CACTCCCATCTATTTGTTTGAGG + Intergenic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1083914839 11:65735022-65735044 CACACCTGACTAATTTTTTTTGG - Intergenic
1083916869 11:65752066-65752088 CATACCCAGCTAATTTTTTTTGG + Intergenic
1083942461 11:65903841-65903863 TACGCCCAGCTAATTTTTTTTGG + Intergenic
1084239874 11:67811751-67811773 TACATCCAGCTAATTTATTGTGG + Intergenic
1084318907 11:68362532-68362554 CACACCCAGCTAATTTTTGGGGG - Intronic
1084365805 11:68697392-68697414 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1084615744 11:70234692-70234714 CACACCCAGCTAATTTTGATGGG + Intergenic
1084842965 11:71872569-71872591 CACGCCCAGCTATTTTTTTTTGG - Intronic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085927909 11:81044046-81044068 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1087818726 11:102687869-102687891 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1088398829 11:109400272-109400294 TACACACACCTCATTTTTTTTGG - Intergenic
1089193640 11:116677241-116677263 CACACCCAGCTAAATTTTTTTGG - Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1090300607 11:125634477-125634499 CACACCTGGCTAATTTGTTGTGG + Intronic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1090916129 11:131164644-131164666 CTCACCTACTTATTTTTTTGTGG + Intergenic
1091079011 11:132648656-132648678 CATGCCCAGCTAATTTTTTCTGG + Intronic
1093206454 12:16257105-16257127 CACACCCACATATGTGTTTGTGG - Intronic
1093406327 12:18809492-18809514 CACGCCCGGCTAATTTTTTGTGG + Intergenic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1094538750 12:31345307-31345329 CACGCCCAGCTAATTTTTCTGGG + Intergenic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1096064205 12:48726357-48726379 CACACCCAACTAATTTCTGTGGG + Intergenic
1096315321 12:50559574-50559596 CACACCTGGCTAATTTTTTGTGG - Intronic
1096722104 12:53530898-53530920 CTCACCCAGCCTATTTTTTGAGG + Intronic
1097099826 12:56579474-56579496 CACACCCGGCTAATTTTTTTTGG - Intronic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1098543951 12:71690304-71690326 CATGCCCAGCTAATTTTTTCTGG + Intronic
1099150179 12:79101627-79101649 CACACCAAGCTTATTTATTGAGG - Intronic
1099908401 12:88799600-88799622 CACAGCCAGCTAATTTTTCTGGG + Intergenic
1100315232 12:93439319-93439341 CACACCCAGCTAATTTTTGTAGG - Intronic
1100414360 12:94356390-94356412 CACCCCCTCATTATTTTTTGAGG + Intronic
1100534351 12:95492719-95492741 AACGCCCAGCTAATTTTTTTTGG + Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101496929 12:105263570-105263592 CACATACACCTCATTTTTTAAGG - Intronic
1101905496 12:108822180-108822202 CACAGCCAGCTAGTTTTTTGTGG - Intronic
1102230544 12:111258840-111258862 CACACCTGACTAATTTTTTCAGG + Intronic
1103440298 12:120958008-120958030 CACACCCTGCTAAATTTTTTTGG + Intergenic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1103774403 12:123355624-123355646 TGCACCCAGCTAATTTTTTGAGG - Intronic
1103885023 12:124193949-124193971 CACAATCACCTAATATTTTCAGG - Intronic
1104617922 12:130285766-130285788 CACACCTGGCTAATTTTTTTTGG - Intergenic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1105464049 13:20620720-20620742 CACGCCTGGCTAATTTTTTGTGG + Intronic
1105483877 13:20806707-20806729 CACATCCAGCTAATTTTTGCAGG + Intronic
1105777734 13:23678609-23678631 CACACCCGGCTAATTTTTGTGGG + Intergenic
1107479762 13:40776368-40776390 CATACCCAGCTAACTTTTTTTGG - Intergenic
1107605776 13:42054748-42054770 CTCACATACTTAATTTTTTGTGG - Intronic
1108405849 13:50100754-50100776 CACACTTGGCTAATTTTTTGTGG - Intronic
1109408854 13:61938181-61938203 CATGCCCAGCTAATTTTTGGGGG + Intergenic
1109861185 13:68201274-68201296 CACACCTGGCTAATTTTTTTTGG - Intergenic
1110461437 13:75749823-75749845 CACCCCCACCTTTTTTTTTTTGG + Intronic
1110584687 13:77175083-77175105 CACACTCAGTTAATTTTTTAGGG + Intronic
1111024942 13:82508984-82509006 CACACCTGGCTAATTTTTTGTGG - Intergenic
1111453754 13:88453078-88453100 CACACCCGGCTAATTTTTTTTGG + Intergenic
1111984154 13:95049040-95049062 CACACCCTGCTCGTTTTTTGGGG - Intronic
1112011257 13:95295663-95295685 GACACCTAGCTAATTTTTTGAGG - Intronic
1112287672 13:98118441-98118463 CAAGCCCAGCTAATTTTTAGTGG + Intergenic
1112522130 13:100105683-100105705 CACACCCAGCTAATTTTTGTGGG - Intronic
1113484065 13:110641870-110641892 CCCTCCCACCTCATTTTTTATGG + Intronic
1114541469 14:23463285-23463307 CACGCCCAACTAATTTTTGTGGG - Intergenic
1115180339 14:30618492-30618514 CACACACACATACTTTGTTGGGG + Exonic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1115488902 14:33939899-33939921 CACCCCCACCTCATTTTTGAGGG + Intronic
1115575514 14:34706961-34706983 CACATGCACCTTATTTTTGGGGG - Exonic
1117151481 14:52892609-52892631 CACGTCCAGCTAATTTTTTTTGG + Intronic
1117421627 14:55552245-55552267 CACGCCCGGCTAACTTTTTGTGG + Intergenic
1117682257 14:58216279-58216301 CACACCCAGCTAATTTTTGGGGG + Intronic
1117865177 14:60140661-60140683 CACACCAACCTCACTTTTTCAGG - Exonic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118358731 14:65037934-65037956 GACACCCAGCTAATTTTTACGGG + Intronic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1119096189 14:71833843-71833865 CAAACCCAGCTAAGTTTTGGGGG - Intergenic
1119452048 14:74719983-74720005 CACGCCCGGCTAATTTTTTTTGG - Intronic
1119825648 14:77655193-77655215 CACACCCACCTATTGTTGAGGGG + Intergenic
1120167527 14:81217633-81217655 CACTCCTGGCTAATTTTTTGTGG - Intronic
1121091902 14:91188671-91188693 CACAGCCCGCTAATTTTTTTTGG - Intronic
1121202278 14:92128324-92128346 CACGCCCAGCTAATTCTTTTTGG - Intronic
1121552697 14:94814284-94814306 CCCACCCACATATTATTTTGGGG - Intergenic
1122997174 14:105271558-105271580 CACACCCTCCTCATCTTGTGAGG - Intronic
1123714886 15:23020427-23020449 CATGCCCGGCTAATTTTTTGGGG - Intronic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1124407864 15:29407820-29407842 CACACCCCACTAATTTTTTGGGG + Intronic
1124477733 15:30049507-30049529 CACACCCAGCAAATTTTTTTTGG + Intergenic
1125541714 15:40473432-40473454 CCTACCCACCTACTTTTTTAGGG - Exonic
1125559028 15:40612332-40612354 CATACCTGGCTAATTTTTTGGGG - Intronic
1125653155 15:41333733-41333755 CACGCCCGGCTAATTTTTTAAGG - Intronic
1125702876 15:41703962-41703984 CACACCTGGCTAATTTTTTTTGG + Intronic
1126622584 15:50654842-50654864 CACACCCGGGTAGTTTTTTGTGG - Intronic
1126735727 15:51730357-51730379 CACACCCAGCTAAATGTTTTGGG - Intronic
1127203343 15:56683648-56683670 AAAACCCACCTAAATTTTTAGGG - Intronic
1127340502 15:58038402-58038424 CACACCCAAATAATTTTTAAGGG + Intronic
1128747475 15:70124657-70124679 GACACCCAGCTAATTTTTGTGGG - Intergenic
1128907687 15:71482740-71482762 CACACACGGCTAATATTTTGTGG + Intronic
1128934394 15:71732936-71732958 CACACCCACCCCATGTTCTGGGG - Intronic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1130138956 15:81207077-81207099 CACGCCTGGCTAATTTTTTGTGG - Intronic
1131104604 15:89724043-89724065 CACGCCCAGCTATTTTTTTTTGG - Intronic
1132173516 15:99688598-99688620 CACGCCCGGCTAATTTTTTGTGG - Intronic
1132361480 15:101219921-101219943 CACGCCCGGCTAATTTTGTGAGG + Intronic
1132824186 16:1894927-1894949 CACGCCCAGCTAATTGTTTTTGG + Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1133630776 16:7618642-7618664 TACACCAACTTAATTTGTTGGGG - Intronic
1133902775 16:9993071-9993093 CATACCTGGCTAATTTTTTGGGG - Intronic
1134087522 16:11368309-11368331 GACACCCAGCTAATTTTTTTTGG + Intronic
1134396677 16:13871464-13871486 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134440595 16:14297514-14297536 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1135030880 16:19037624-19037646 CACACCCAGCTAATTCTTCTGGG + Intronic
1135166342 16:20142477-20142499 CACACACACACAATTTTTTGTGG + Intergenic
1135493418 16:22930567-22930589 CAAACTCAGCTAATTTTGTGGGG - Intergenic
1135861856 16:26063538-26063560 CACACCTAGCTAATTTTTAATGG - Intronic
1136430016 16:30191608-30191630 CATGCCCAGCTAATTTTTGGGGG - Intergenic
1137328134 16:47461593-47461615 CTCTGCCACCTAATTTTTAGAGG - Intronic
1137998602 16:53248680-53248702 CACACCCAGCTAATTTATTTTGG + Intronic
1138356423 16:56384729-56384751 CACACACACTCAATTTTTGGAGG + Intronic
1139508890 16:67415300-67415322 CACGCTCAGCTAATTTTTTAAGG - Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1139571739 16:67817120-67817142 CACACCTGGCTAATTTTTTGCGG + Intronic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139626493 16:68193510-68193532 CACACCCAGCTAATTTTTGTAGG - Intronic
1139697684 16:68686809-68686831 CACACCCAGCTTATTTTTTTTGG - Intronic
1139806710 16:69571914-69571936 CACGCCCGGCTAATTTTTTTTGG + Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1140007251 16:71090654-71090676 CACACCCAACTAATTTTTGTGGG + Intronic
1140047362 16:71450560-71450582 CACACCCGGCTAATTTTTTGTGG - Intronic
1140525292 16:75617938-75617960 CACACCCAGCTAACTTTTCCTGG - Intronic
1140667347 16:77239754-77239776 GTCACTCACCTAATTTTTTAGGG - Intergenic
1140785382 16:78336348-78336370 CACACCTGGCTAATTTGTTGTGG - Intronic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1141102208 16:81206056-81206078 CCCACCCACCTTTTTTTTGGGGG - Intergenic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1141494544 16:84398247-84398269 CACACCCCACTAAATTTTTTTGG - Intronic
1141542513 16:84736943-84736965 CTCGCCCGGCTAATTTTTTGTGG + Intronic
1142254686 16:89008024-89008046 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254778 16:89008436-89008458 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254824 16:89008637-89008659 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254861 16:89008809-89008831 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254868 16:89008842-89008864 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254899 16:89008979-89009001 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254913 16:89009046-89009068 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254928 16:89009113-89009135 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254941 16:89009180-89009202 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254956 16:89009247-89009269 CACACCCACCTCATCTTTGCAGG + Intergenic
1142254971 16:89009314-89009336 CACACCCACCTCATCTTTGCAGG + Intergenic
1142536306 17:619426-619448 CACACCCCACTAATATTTTCCGG + Intronic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1143573117 17:7773434-7773456 CACACCCACCTAAGAACTTGGGG - Intronic
1143819451 17:9547945-9547967 CACACCCAGCTAATTTTTGTGGG + Intronic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1145716509 17:27028220-27028242 CATACCCAGCTAATTTTTGTGGG - Intergenic
1145915164 17:28569311-28569333 CACACCCAGCTGATTTGTTTTGG - Intronic
1146373200 17:32278004-32278026 CACACCCAGCTGATTTTTAAGGG - Intronic
1146999393 17:37350361-37350383 CACACCCAGCTAATTTTTTCTGG - Intronic
1147028740 17:37612223-37612245 CACACCCGGCTAACTTTTTTTGG + Exonic
1147610701 17:41800414-41800436 CACACCTGGCTAATTTTTTGGGG - Intergenic
1147801679 17:43095423-43095445 CACACCCGGTTAATTTTTTGTGG - Intronic
1148004709 17:44417369-44417391 CACATCCAGCTAATTTTTGGGGG + Intronic
1148009184 17:44461845-44461867 CAAGCCCAACTAATTTTTGGGGG + Intronic
1148087027 17:45000502-45000524 TACACCAACCTAATATTTTCAGG + Intergenic
1148432841 17:47656389-47656411 CACACCCAGCTAACTTTTTTGGG - Intronic
1148511917 17:48178177-48178199 CAAACTCATCTTATTTTTTGAGG + Intronic
1148832273 17:50441325-50441347 CACACCCAGCTAAATTTTTTTGG + Intronic
1149019463 17:51946305-51946327 CTCACACACTTATTTTTTTGTGG - Intronic
1149483079 17:57018962-57018984 CACGCCCGGCTAATATTTTGAGG + Intergenic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149674733 17:58449541-58449563 CACACCCAGCTAATTTTTGCAGG - Intronic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1150093508 17:62351579-62351601 CACACCCAGCTAATTTTTGTGGG + Intergenic
1150349246 17:64430023-64430045 CACACCCAACTAATTTTTGTGGG + Intergenic
1150742387 17:67789876-67789898 CACACCTGACTAATTTTTTTGGG + Intergenic
1150779441 17:68108808-68108830 GACTCCCAGCTAATTTTTTTGGG + Intergenic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1151308305 17:73278124-73278146 CACGCCCAGCTAATTTTAAGCGG + Intergenic
1151731091 17:75911673-75911695 CACGCTCAGCTATTTTTTTGTGG + Intronic
1152125974 17:78447093-78447115 CTCACCTAGCTATTTTTTTGTGG + Intronic
1152607881 17:81302199-81302221 CACACCCGGCTAATTTTGTGGGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154056615 18:11018805-11018827 CATACCCACATATCTTTTTGAGG + Intronic
1154345676 18:13541917-13541939 CACACCCCACTAATTTTTTTGGG - Intronic
1155142357 18:23054755-23054777 CACGCCCAGCTAATTTTTATGGG + Intergenic
1155313521 18:24547999-24548021 CTCACCCAGCTAATATTTGGAGG + Intergenic
1155352483 18:24920070-24920092 CACACCCAGCTAATTTTGTGGGG - Intergenic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1156243352 18:35274170-35274192 CATGCCCAGCTAATTTTTGGGGG + Intronic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1157931856 18:51832302-51832324 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1158032904 18:52988793-52988815 CACACACATGTAATTTTTTGTGG + Intronic
1158696927 18:59711775-59711797 CACACCTGGCTAATTTTTTTTGG - Intergenic
1158800941 18:60908016-60908038 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159105290 18:63997293-63997315 CACACCCACCTGGATATTTGAGG - Intronic
1159191028 18:65042894-65042916 CACGTCCAGCTAATTTTTTGGGG + Intergenic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1160536131 18:79593938-79593960 CACATCTGGCTAATTTTTTGGGG - Intergenic
1161032246 19:2062962-2062984 GACACCCAGCTAATTTGTTTTGG + Intergenic
1161272308 19:3396797-3396819 CACACCCAGCTAATTTTTGTAGG - Intronic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161529370 19:4778064-4778086 CACGCCTGGCTAATTTTTTGGGG + Intergenic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1161968531 19:7562213-7562235 CACACCCAGCTAAATTTTGTGGG + Intergenic
1161976379 19:7610159-7610181 AACACCAGGCTAATTTTTTGTGG - Intronic
1162291962 19:9786650-9786672 CACAGCAGGCTAATTTTTTGTGG + Intronic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162468177 19:10855489-10855511 CACACCTGGCTAATTATTTGTGG + Intronic
1162515943 19:11147723-11147745 CACACCCGGCTAATTTTTACAGG + Intronic
1162648480 19:12067041-12067063 CACACCCAGCTAATTTTTTATGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1162809850 19:13157246-13157268 CTCAGCCTCCTAAATTTTTGGGG - Intergenic
1162839908 19:13348849-13348871 CACACCCAGCTAATTTTGGGGGG - Intronic
1163112802 19:15171504-15171526 CACACCTGGCTAATTTTTGGGGG + Intronic
1163760050 19:19131521-19131543 CACACACACACAATTTTTTGGGG + Intronic
1163933710 19:20422998-20423020 CACACCCGGCTAATTTTGTGTGG - Intergenic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1165430962 19:35772460-35772482 CAGGCCCAGCTAATTTTTAGTGG - Intergenic
1166111657 19:40626694-40626716 CACCCCCATCTAATTTCTTCAGG + Intronic
1166319921 19:42011136-42011158 CACACACCCCTAATGTATTGTGG + Intronic
1166757911 19:45205156-45205178 CACACACACACAATTTCTTGTGG - Intronic
1166977820 19:46615030-46615052 CACACCTGGCTAATTTTTTTTGG - Intergenic
1167369969 19:49074716-49074738 CACACGCGGCTAATTGTTTGTGG + Intergenic
1167736678 19:51298696-51298718 CAGACCCACCTACATTATTGAGG + Intergenic
1167750571 19:51377185-51377207 CACTCCCAGCTAATTTTTTGGGG - Intergenic
1167892090 19:52548577-52548599 CACACCCGGGTAATTTTTGGTGG + Intronic
1167947428 19:52999984-53000006 CACATCCAGCTAATTTTTAGTGG - Intergenic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168223049 19:54974954-54974976 CAGGCCCGGCTAATTTTTTGTGG + Intronic
1168428162 19:56256347-56256369 CACACCCGGCTAATCTTTTGTGG + Intronic
1168432483 19:56292417-56292439 CACACCTAGCTAATTATTTTTGG + Intronic
1168624067 19:57902815-57902837 CATGCCCGGCTAATTTTTTGTGG + Intronic
925567512 2:5272155-5272177 CCCACCCACTTTATCTTTTGGGG - Intergenic
925940814 2:8816006-8816028 CCCACCCACCCAATCCTTTGAGG + Intronic
926180252 2:10636449-10636471 CACACCCAGCTAATTTTGTTTGG - Intronic
927724197 2:25408380-25408402 CACACCCAACTAATTTTTGTTGG - Intronic
928334962 2:30390149-30390171 CACACCCACCTAAGTGCTTTTGG + Intergenic
928508875 2:31983102-31983124 CACACCCAGCTAATTTTTGTGGG - Intronic
928966749 2:36983569-36983591 CACACCCAGCTAATATTTTTGGG - Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
929126692 2:38529143-38529165 CACACCCAGCAAATTTTTTTTGG + Intergenic
930119185 2:47746126-47746148 CACACCTGGCTAATTTTTAGTGG - Intronic
931270006 2:60693275-60693297 CACGCCCGGCTAATTTTTTTTGG - Intergenic
931329665 2:61267597-61267619 TACACCCAGCTAATTTTTTGTGG + Intronic
932833022 2:75008845-75008867 CAAATCCACCTTTTTTTTTGTGG + Intergenic
933506906 2:83188257-83188279 CACACACACATACTTTTTTAAGG - Intergenic
933720809 2:85396340-85396362 CACACTCAGCTAATTTTGGGGGG + Intronic
935033576 2:99345784-99345806 CACACTCAGCTATTTTTTTTAGG - Intronic
935159195 2:100514589-100514611 CATGCCTAGCTAATTTTTTGGGG + Intergenic
935632839 2:105226074-105226096 CACACCCAGCTAATTTTTGTGGG - Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
935969436 2:108516099-108516121 CACGCCCGTCTAATTTTTTTGGG + Intergenic
936971053 2:118176605-118176627 CACCCCCACCTACTGTTTAGGGG + Intergenic
937108012 2:119337209-119337231 CATGCCCAGCTAGTTTTTTGGGG + Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937650355 2:124312519-124312541 CACACCCAACTAATTTTTGTGGG + Intronic
937972630 2:127562451-127562473 CACGCCCAGCTAATTTTTGTGGG + Intronic
938043830 2:128098591-128098613 CACACTCAGCTATTTTTTTCTGG - Intronic
938272289 2:129983720-129983742 CACGCCCAGCTAATTTTTGTAGG - Intergenic
938398818 2:130970736-130970758 CAGACCCACATAATTTTTATTGG + Intronic
938963279 2:136362078-136362100 CACAGCCACCTAATTTAGTCAGG + Intergenic
939528113 2:143321843-143321865 CACACCCTGCTACATTTTTGTGG + Intronic
940212643 2:151271552-151271574 CACAACAACTTTATTTTTTGTGG + Intronic
940415068 2:153410239-153410261 CACACTCAGCTATTTTTTTAGGG + Intergenic
940882728 2:158962638-158962660 CACGCCCAGCTAATTTTTATTGG - Intergenic
942135527 2:172921251-172921273 CATGCCCAGCTAGTTTTTTGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
942345438 2:174997841-174997863 CACACCCAGCTAATTTTTGTTGG - Intronic
944150310 2:196551260-196551282 CACACCCACTTCATTTTATTAGG + Intronic
944767520 2:202879575-202879597 CACACCCGGCTAATTTGTTTTGG + Exonic
944831763 2:203540135-203540157 CACGCCTGGCTAATTTTTTGTGG + Intergenic
945285848 2:208080637-208080659 CACACCTGGCTAATTTTTTGTGG - Intergenic
945890813 2:215428856-215428878 CACAGCCGGCTAATTTTTTTTGG - Intronic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
946288706 2:218726620-218726642 CACATCCAGCTAATTTTTTCTGG + Intronic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
948013896 2:234672241-234672263 CGCACCCAGCTGATTTTTTTAGG + Intergenic
948278579 2:236728944-236728966 CCCACCCACCCCATTTGTTGTGG + Intergenic
948436865 2:237959728-237959750 TGCGCCCAGCTAATTTTTTGTGG - Intergenic
948900109 2:240952188-240952210 CATGCCCGGCTAATTTTTTGTGG - Intronic
1168791829 20:582817-582839 CACACCCGGTTAATTTTTTTTGG - Intergenic
1168862247 20:1053952-1053974 CACGCCCAGCTAATTTTGTATGG - Intergenic
1168969383 20:1920312-1920334 CACACCCATCAAACATTTTGAGG - Intronic
1169043176 20:2512941-2512963 CACACCCAGCTATTTTTGAGGGG - Intronic
1169076705 20:2764443-2764465 CACACCCAGCTAATTTTTTAGGG + Intergenic
1169126759 20:3133907-3133929 CACATCCGGCTAATTTTTGGGGG + Intronic
1169396301 20:5233030-5233052 CACACCCAGCTTATTTTTTTTGG - Intergenic
1169951887 20:11053856-11053878 CTCACCAACATACTTTTTTGTGG - Intergenic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1172609946 20:36243012-36243034 CACGCCCAGCTAATTATTTTTGG + Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1173679778 20:44869861-44869883 AAGGCCCAGCTAATTTTTTGTGG - Intergenic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174316728 20:49708773-49708795 CACACCCGGCTAATTTTTGATGG - Intronic
1174470906 20:50759871-50759893 CACACTCAGCTAATATTTTTCGG + Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174596162 20:51685403-51685425 CACGCCCAGCTAACTTTTTTTGG - Intronic
1174641365 20:52047282-52047304 CATGCCCAGCTAATTTTTGGTGG + Intergenic
1175058099 20:56216509-56216531 CATGCCCAGCTAATTGTTTGGGG - Intergenic
1176202720 20:63869969-63869991 CACACCTGGCTAATTTTTGGGGG - Intronic
1176920716 21:14684363-14684385 CACTCCCACCTCATTTTTAATGG + Intergenic
1177965105 21:27718006-27718028 CACGCCCGACTAATTTTTTTTGG + Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1179768930 21:43598359-43598381 CACACCCGGCTAATTTTTGTGGG + Intronic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181309369 22:21936014-21936036 CACACACAGCTAATTTTTTTTGG - Intronic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1182386974 22:29952043-29952065 CACGCCCAGCTAATTTTTGTGGG + Intronic
1182634891 22:31718226-31718248 CCCGCCCAGCTAATTTTTTGGGG + Intronic
1182760221 22:32716685-32716707 CATACCCGGCTAATTTTTTGTGG + Intronic
1183132681 22:35854428-35854450 CATACCCAGCTAATTTTTTTGGG - Intronic
1183813218 22:40275800-40275822 CACACCCAGCTAATTTTTGTAGG - Intronic
1184721272 22:46315043-46315065 CACACCCGGCTAATTTTTGTGGG + Intronic
1185287217 22:50007525-50007547 CACACTCAGTTAATTTTTTTGGG + Intronic
1185294860 22:50048106-50048128 CACACACACACACTTTTTTGGGG - Intronic
949185992 3:1191997-1192019 GACACCTACCTACTTTATTGCGG + Intronic
949383967 3:3479236-3479258 CACAGACAAATAATTTTTTGAGG + Intergenic
949496234 3:4634893-4634915 CACACCTGGCTAATTTTTGGGGG + Intronic
950438656 3:12994734-12994756 CACACCCTCCTGACTGTTTGGGG + Intronic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
951333618 3:21394804-21394826 CACACCGAGCTAATTTTTTGTGG + Intergenic
951351119 3:21608164-21608186 CACACTTGGCTAATTTTTTGTGG + Intronic
951667822 3:25146659-25146681 CGCGCCCGGCTAATTTTTTGTGG + Intergenic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
953801457 3:46027035-46027057 CACACCTAGCTAATTTTTTGGGG + Intronic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
954820050 3:53318146-53318168 CACTATCAGCTAATTTTTTGGGG - Intronic
954835842 3:53467224-53467246 CAGCCCCAGCTAATTTTTTATGG - Intergenic
954883846 3:53854958-53854980 CACGCCCGGCTAATTTTTTGTGG - Intronic
955094581 3:55784648-55784670 CACACCCACCCCATTTTTCTAGG + Intronic
955599407 3:60629045-60629067 AACATCCACCTAATTAGTTGGGG + Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956462847 3:69488734-69488756 CATGCCCAGCTAATTTTTAGTGG - Intronic
957368287 3:79255671-79255693 CACACACACATAATATTTTGTGG + Intronic
959364997 3:105446476-105446498 CATACCAACCTAATTTTCTTTGG - Intronic
959538382 3:107512705-107512727 CACGCCCAGCCAATTTTTTTTGG - Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
960163185 3:114372686-114372708 CACAGCCAGCTAGTTTTTTGGGG - Intronic
960809598 3:121615046-121615068 CACACCCAGCAAACTTTTTGTGG - Intronic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961139011 3:124539902-124539924 CACACCAAGCTAATTTTTTTTGG + Intronic
961837752 3:129678082-129678104 CACACCTGGCTAATTTTTAGTGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962623966 3:137206797-137206819 CACATCCAATTAATTTTTGGTGG + Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963315144 3:143751283-143751305 CAGATCCACCTAATTGTTGGTGG + Intronic
963716097 3:148805538-148805560 CACGCCCGGCTAATTTTTTGTGG - Intronic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
965492927 3:169362128-169362150 TACACCAACCTAATATATTGGGG - Intronic
965819870 3:172674285-172674307 CACACCCGGCTAATTTTCTTTGG - Intronic
966178484 3:177165931-177165953 CATGTCCAGCTAATTTTTTGTGG - Intronic
966520773 3:180871136-180871158 GCCACCCACCTAATGTTTTCTGG + Intronic
966547223 3:181163320-181163342 TACGCCCAGCTAATTTTTGGTGG - Intergenic
966716143 3:183014868-183014890 TACACCCAGCTTATTTTTTGTGG + Intergenic
967032885 3:185624709-185624731 CAGACCCAGTTAATTTTTAGTGG - Intronic
967148893 3:186630202-186630224 CACACCCAGCTAATTTTTGTGGG + Intergenic
967200893 3:187071602-187071624 CACGCCCGGCTAATTTTTTGGGG - Intronic
967768031 3:193303914-193303936 CACACACACATAATTTTTGCTGG + Intronic
967960934 3:194923435-194923457 CATGACCAGCTAATTTTTTGTGG + Intergenic
968277230 3:197449634-197449656 CACGACCAGCTAATTTTTTATGG - Intergenic
968429409 4:546854-546876 CACACCCAGCTAAATATTTAGGG + Intergenic
968775996 4:2540488-2540510 CACGCCTGGCTAATTTTTTGGGG - Intronic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969365503 4:6691853-6691875 CACACCAGGCTAATTTTTTGGGG - Intergenic
969953932 4:10868592-10868614 CACACCCTGCTAATTTTTCTTGG + Intergenic
970528144 4:16953811-16953833 CAAACCCAGCTCCTTTTTTGTGG + Intergenic
970618483 4:17791585-17791607 CACACCCAGCTAATTTTTGTAGG - Intergenic
970885976 4:20987842-20987864 CACGCCCGGCTAATTTTTTTTGG - Intronic
970894880 4:21090438-21090460 GACACCTACCTAAGTTTTGGGGG - Intronic
971908420 4:32760291-32760313 CACACTCAGCTAATTTTTGCGGG - Intergenic
972392007 4:38622648-38622670 CACACCTGGCTAATTTTTTGTGG + Intergenic
972626419 4:40803903-40803925 CACACCTGGCTGATTTTTTGTGG - Intronic
972709029 4:41575049-41575071 CACACACACACAATTTATTGAGG + Intronic
973103403 4:46300463-46300485 TTCACCCACCTAATTTTTCTTGG + Intronic
973857249 4:55025168-55025190 CCCACCCACCTCATTTCATGAGG + Intergenic
973947812 4:55977657-55977679 CTCACCAACTTATTTTTTTGTGG + Intronic
974053312 4:56961359-56961381 CACACCTGGCTAATTTTTTTGGG + Intergenic
974514649 4:62894053-62894075 CACACACACAATATTTTTTGTGG + Intergenic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
975649451 4:76578131-76578153 AACACACCCCTAATTTTATGGGG + Intronic
976779973 4:88748044-88748066 CACGCCCGGCTAATTTTTTTTGG + Intronic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
980072205 4:128255193-128255215 CACACACACGTAATTAATTGTGG + Intergenic
980102684 4:128557411-128557433 CACACTCAGCTAATTTTTTCTGG + Intergenic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
981240126 4:142466996-142467018 CACTCCCACCTAGATTTTAGAGG + Intronic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981998756 4:151002855-151002877 TACACCCAGCTAATTTTTTGGGG - Intronic
983167473 4:164495950-164495972 CACTCCCGGCTAATTTTTTTTGG - Intergenic
983328073 4:166285888-166285910 CACCCGCAGCTAATTTTTTTGGG + Intergenic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
985272564 4:188207912-188207934 CACACACACACACTTTTTTGTGG - Intergenic
985300388 4:188482257-188482279 CACACCTGGCTAATTTTTTTTGG + Intergenic
986477700 5:8152679-8152701 CACCCCCACCTCCTTTTTTTTGG - Intergenic
987088262 5:14488571-14488593 CTCACGCACCTATTTTTTGGAGG + Intronic
987553495 5:19414525-19414547 CACACACACCTTATTTTATGAGG - Intergenic
987592734 5:19952204-19952226 CACACCTGGCTAATTTTTTGTGG + Intronic
987633549 5:20508905-20508927 CACACCCTCCTAATGTCTAGTGG + Intronic
987913572 5:24182778-24182800 CACACCTAACTACTTTATTGGGG - Intergenic
987939989 5:24521448-24521470 CATGCCCACCTAATTTTGTAAGG - Intronic
987985667 5:25142285-25142307 CACGCCCAGCTAATTTTTAGTGG + Intergenic
989810492 5:45666907-45666929 CCCACCCCCCTGATTTTTTCTGG - Intronic
990169586 5:53033110-53033132 CACGCCCTGCTAATTTTTTATGG - Intronic
991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG + Intronic
991457480 5:66819928-66819950 CATACCCAGCTAATTTTTGTGGG + Intronic
991481221 5:67082303-67082325 CACGCCCAGCTAATTTTTGTTGG + Intronic
992113127 5:73514789-73514811 CACACCCAGCTAATTTATTTTGG - Intergenic
992666786 5:79018202-79018224 CATGCCCGGCTAATTTTTTGTGG + Intronic
993273773 5:85830235-85830257 CACACCCAGTTAATTTTTGTGGG + Intergenic
993277151 5:85874672-85874694 CACACCCACAGAATTTACTGTGG + Intergenic
993809920 5:92463537-92463559 CACACCCAGCTAAATGTTTCTGG - Intergenic
994260643 5:97654751-97654773 CACAGCTACCTATTTTTGTGTGG - Intergenic
995442568 5:112208087-112208109 CACTCCCAGCTAATTTTTGTAGG - Intronic
996071919 5:119140738-119140760 CCTCCCCAACTAATTTTTTGAGG + Intronic
996638697 5:125727742-125727764 CATGCCCAGCAAATTTTTTGTGG + Intergenic
997009122 5:129856144-129856166 CACACTGGGCTAATTTTTTGTGG - Intergenic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
998508570 5:142692178-142692200 CACACCCAGCTAATTTTTGTGGG - Intronic
999051865 5:148531604-148531626 CAAACCCACTTAATTTTTCTAGG + Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999682656 5:154074564-154074586 CACACCCAGCTAATTGTGTGGGG + Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
999928680 5:156407237-156407259 CACACCTGCCTAAATTTTTATGG + Intronic
1000092426 5:157941244-157941266 CACGCCCAGCTAATTTTTGTGGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1000310618 5:160040741-160040763 CACTCCCAGCTAATTTTGTTTGG + Intronic
1000326740 5:160178005-160178027 CGCACCCCCCTTTTTTTTTGAGG + Intergenic
1000340945 5:160276939-160276961 AACACCCAGCTAATTTTTGTGGG + Intronic
1000613768 5:163405469-163405491 CATGCCCACCTAATTATTTTTGG + Intergenic
1001191356 5:169635562-169635584 CACACCAACCAAATGTATTGAGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1001962621 5:175889116-175889138 CACACTCAACTAATATTTTGGGG - Intergenic
1001978066 5:176016996-176017018 CACAACGACCTAATTATTTAAGG + Intronic
1001978201 5:176018177-176018199 CACATCCAGCTAATTTTTAGGGG + Intronic
1002015531 5:176318950-176318972 TAAGCCCAGCTAATTTTTTGTGG - Intronic
1002220717 5:177678533-177678555 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1002239218 5:177825585-177825607 CACATCCAGCTAATTTTTAGGGG - Intergenic
1002239353 5:177826766-177826788 CACAACGACCTAATTATTTAAGG - Intergenic
1002392240 5:178924214-178924236 CATGCCCGGCTAATTTTTTGTGG - Intronic
1002592044 5:180297283-180297305 CACACCCGGCTAATTTTTTTTGG - Intergenic
1002892448 6:1347264-1347286 CACACCTACCTAGTGTTCTGAGG + Intergenic
1003836588 6:10077875-10077897 CACACCTGGCTAATTTTTAGTGG - Intronic
1003923782 6:10857907-10857929 CACACCCACTTAATTAGCTGTGG - Intronic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1004447927 6:15718291-15718313 CACACCCAGCTAATTTATAAGGG - Intergenic
1004814350 6:19296479-19296501 CACATCCGGCTAATTTTTTTTGG - Intergenic
1004896243 6:20150718-20150740 TACGCCCAGCTAATTTTTTTTGG + Intronic
1005544469 6:26850506-26850528 TACGCTCAGCTAATTTTTTGTGG - Intergenic
1006142543 6:31938952-31938974 CACACCTGGCTAATTTTTTGTGG + Intronic
1007012400 6:38430376-38430398 CACACCCAACTTATGTTTTATGG + Intronic
1007040404 6:38716113-38716135 CACGCCCGGCTAATTTTTTTTGG + Intronic
1007153950 6:39724294-39724316 CACGCCCGGTTAATTTTTTGTGG - Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1009004452 6:57765425-57765447 CACCCCCGGCTAATTTTTTTTGG - Intergenic
1011602703 6:89074818-89074840 CACATCCAGCTAATTTTTGTGGG + Intergenic
1011605077 6:89095367-89095389 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1012358709 6:98349414-98349436 CACACCCGTCTAATTTTTTGTGG - Intergenic
1012910510 6:105112683-105112705 AACTCCCACCTACTTTTCTGGGG - Intronic
1013315987 6:108943675-108943697 CAAACCCAGCTAATTTTTGTGGG - Intronic
1013530395 6:111014287-111014309 CACACCTGGCTAATTTTTTGTGG + Intronic
1013855570 6:114567937-114567959 CACACCCATTTCCTTTTTTGAGG - Intergenic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1014737075 6:125105956-125105978 CAACCCCAACTAATTTTTTTAGG + Intergenic
1015069360 6:129071996-129072018 CACACCCAGCTAATTTGTTTTGG - Intronic
1015448006 6:133330584-133330606 CACACACACATACTTTTTTGGGG + Intronic
1015586544 6:134782433-134782455 CACACCCGGCTAATTTTTTTGGG - Intergenic
1015967942 6:138713699-138713721 CAAAACCACCTAGGTTTTTGTGG + Intergenic
1016318665 6:142818510-142818532 CACGCCTGGCTAATTTTTTGTGG - Intronic
1016954582 6:149614222-149614244 CACACATACCTAGTTTTTGGAGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1017546085 6:155451779-155451801 CACGCCCAGCTAATATTTTTTGG + Intronic
1017804897 6:157936350-157936372 TACACCCAGCTAATTTTTGGGGG - Intronic
1018014150 6:159696878-159696900 CACACCCAGCTACTGTTTTTTGG - Intronic
1018206278 6:161440105-161440127 CACGCCCGGCTAATTTTTTTTGG + Intronic
1018605003 6:165587617-165587639 CAGACCCACCCAATATTTGGGGG + Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019794794 7:3041726-3041748 CACGCCGGGCTAATTTTTTGTGG + Intronic
1019986132 7:4657235-4657257 CACACCTGGCTAATTTTTTTTGG - Intergenic
1019991645 7:4695957-4695979 CACACCCAGCTAATTTTTGTGGG - Intronic
1020565530 7:9789739-9789761 CAAATCCACCAAATTTTTTTTGG + Intergenic
1020669747 7:11091948-11091970 GACACCTACCTAATTCTTTCAGG - Intronic
1021684492 7:23170055-23170077 CACGCCCGGCTAATTTTTTTTGG - Intronic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022408126 7:30111774-30111796 CACACCCAGCTAATTTTGTATGG + Intronic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1022976859 7:35566681-35566703 CACACATATTTAATTTTTTGAGG - Intergenic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024568054 7:50699980-50700002 CACGCCCGGCTAATTTTTTTTGG - Intronic
1024606143 7:51024150-51024172 CACGCCCGGCTAATTTTTTGTGG - Intronic
1024747701 7:52427395-52427417 CACGCCCAGCTAATTTTTGTTGG + Intergenic
1025004961 7:55346195-55346217 CACAGCCATCTGAATTTTTGAGG - Intergenic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025923522 7:65937548-65937570 TACATCCAGCTAATTTTTTTTGG + Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026550085 7:71360779-71360801 CATACCCAGCTAATTTTTGTGGG - Intronic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026799812 7:73392884-73392906 CACACCTGGCTAATTTTGTGGGG + Intergenic
1026814233 7:73497084-73497106 CACACCCAGCTAATTTTTGTAGG - Intronic
1027646685 7:80810100-80810122 CTCGCCCACGTATTTTTTTGTGG - Intronic
1027787586 7:82599500-82599522 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1028548908 7:92034655-92034677 CACACCCAGCTAATTTTTGTGGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1029589941 7:101500662-101500684 CACGCCCAGCTAATTTTTGTGGG - Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1029715435 7:102322898-102322920 CACGCCTAGCTAATTTTTTTTGG + Intergenic
1029966269 7:104743992-104744014 CACACCCTGCAAATTTTTTTTGG + Intronic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030564618 7:111137979-111138001 CACACCCAGCTAATTTTTGTGGG + Intronic
1030897519 7:115079333-115079355 CACACACACACAATTTTTTCTGG + Intergenic
1031147243 7:118010373-118010395 CACACCCACCTACCTTCTTATGG - Intergenic
1031443754 7:121825734-121825756 CACACCCGGCTAATTTTTTTTGG + Intergenic
1032111411 7:129079065-129079087 CACACACAGCTAATTTTTTAAGG - Intergenic
1032657535 7:133947745-133947767 AACAGCCACATAATTTTTTATGG - Intronic
1032905660 7:136361524-136361546 CACACCTGGCTAATTTTTTGTGG + Intergenic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1033556052 7:142489289-142489311 CACACCCAGCTAATTCTTTTTGG + Intergenic
1033714380 7:143984646-143984668 CGCGCCCAGCTAATTTTTAGTGG - Intergenic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1035215065 7:157359660-157359682 CACACCCAACTATTTTTTTTTGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035707344 8:1686886-1686908 CACACACACATAAATGTTTGAGG + Intronic
1035848639 8:2891777-2891799 CACGCCCAGCTAATTTTTGTAGG + Intergenic
1036144619 8:6243516-6243538 CATACCCAGCTAATTTTCTGTGG - Intergenic
1036155714 8:6340159-6340181 TAAACCCACTGAATTTTTTGAGG + Intergenic
1036164830 8:6422843-6422865 CACGCCCGGCTAATTTTTTGTGG + Intronic
1036181814 8:6592306-6592328 CACACCCGGCTAATTATTTTTGG + Intronic
1036237977 8:7058234-7058256 CTCACCAACTTAATTTTTTAAGG + Intergenic
1036615551 8:10384843-10384865 AACACCCAGCTAATTTTTTTTGG - Intronic
1036958929 8:13222722-13222744 CAAATACACCTAAATTTTTGAGG + Intronic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1037894872 8:22645323-22645345 CACGCCCGGCTAATTTTTGGTGG - Intronic
1037971117 8:23172647-23172669 CACGCCCGGCTAATTTTTTATGG - Intergenic
1038341173 8:26686386-26686408 CACACACACTTATTTTCTTGTGG + Intergenic
1038579985 8:28739481-28739503 CACACCTGGCTAATTTTTTTTGG + Intronic
1039333565 8:36565592-36565614 CAAACCCACCTAATTTATCAAGG + Intergenic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1040651984 8:49459215-49459237 CACACCCGGCTAAGTTTTTTTGG - Intergenic
1040770002 8:50962337-50962359 CACACACACATAATTTTTTAAGG + Intergenic
1040917734 8:52580701-52580723 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1041061519 8:54039401-54039423 CACGCCCGGCTAATATTTTGTGG + Intergenic
1041441283 8:57899520-57899542 CACACCTAGCTAATTTATTTTGG - Intergenic
1041492250 8:58446951-58446973 CATGCCCAGCTAATTTTTTCTGG + Intronic
1042366247 8:67940017-67940039 CACTCCCTCCTAATTTTGGGTGG + Intergenic
1042532384 8:69829519-69829541 CGTGCCCAGCTAATTTTTTGTGG - Intronic
1042717506 8:71790546-71790568 CACACCCCGCTAATTTTTTGTGG - Intergenic
1044212900 8:89571545-89571567 CACGCCCGGCTAATTTTTGGTGG + Intergenic
1044321858 8:90811102-90811124 CATGCCCGGCTAATTTTTTGGGG + Intronic
1045018068 8:98016214-98016236 CACACCAGGCTAATTTTTTGTGG - Intronic
1045089362 8:98724527-98724549 CACACCCACATATTTTTAAGTGG + Intronic
1045220073 8:100190154-100190176 CACATCCAGCTAATTTTTTTTGG - Intronic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1047395316 8:124492478-124492500 CACACCCAGCCAATTTTTTGGGG - Intronic
1047702941 8:127468492-127468514 CACTCCCAGCTAATTTTTGTTGG - Intergenic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048338547 8:133521288-133521310 CACACCCAGCTAATTTTTGGGGG + Intronic
1048652794 8:136498011-136498033 CACACCCAGCTAAATTTTTAGGG - Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1048971913 8:139649921-139649943 CACACCCACCTCTTTCCTTGGGG - Intronic
1049125829 8:140786933-140786955 CACAGCCACCAACTTTTTTTTGG + Intronic
1049186181 8:141255246-141255268 TACACCCAGCTAATTTTTCTAGG + Intronic
1050465516 9:5918700-5918722 CACACCAACCTAATACTTGGGGG + Intronic
1050708243 9:8428663-8428685 CACACACACACAATTTTTTTTGG - Intronic
1051413507 9:16814755-16814777 CACACCCACCAAATATCTAGGGG + Intronic
1051466432 9:17383355-17383377 CACACCCAACTTTTTTTTTTTGG - Intronic
1051641442 9:19228551-19228573 CACACCCCACTAATTTTTTGGGG - Intergenic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1053119156 9:35532587-35532609 CACACCCAGCTATATTTTTGTGG - Intronic
1053611337 9:39716135-39716157 CACACCCGGCTAATTTTTTTAGG + Intergenic
1053797113 9:41736648-41736670 CATACCCGGCTAATTTTTTTTGG + Intergenic
1054086917 9:60755025-60755047 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054148084 9:61578220-61578242 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054185527 9:61948729-61948751 CATACCCGGCTAATTTTTTTTGG + Intergenic
1054242183 9:62626257-62626279 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054467824 9:65509314-65509336 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054751486 9:68911724-68911746 CACACCTGACTAATTTTTTGTGG - Intronic
1054781163 9:69167082-69167104 CACGCCCAGCTAATTTTTCTGGG - Intronic
1054849146 9:69828524-69828546 CACACCCGGCTAATTTTTGGTGG - Intronic
1054995663 9:71385859-71385881 CACACCTGGCTAATTTTTTTTGG + Intronic
1055018127 9:71641175-71641197 CACACCCAGCTAATTTTTGTAGG - Intergenic
1055219499 9:73911196-73911218 CATGCCAAGCTAATTTTTTGGGG - Intergenic
1055279660 9:74659645-74659667 CACACCTGGCTAATTTTTTGTGG + Intronic
1056368852 9:85934098-85934120 CACACCTGGCTACTTTTTTGGGG - Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1058454076 9:105123159-105123181 CACACCCAGCTAATTTTTGGTGG - Intergenic
1058660800 9:107266790-107266812 CACACCTGGCTTATTTTTTGTGG + Intergenic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059173453 9:112148306-112148328 CAAACCCTCCTAATTTTTAGCGG - Intronic
1059226367 9:112676545-112676567 CACACCTGGATAATTTTTTGTGG - Intergenic
1059914700 9:119085971-119085993 CACACCCAGCTAATTTTTGTGGG - Intergenic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1061562312 9:131413530-131413552 CACACCCAGCTAATTTTTAGTGG + Intronic
1061616942 9:131786620-131786642 CATGCCTAGCTAATTTTTTGTGG + Intergenic
1061690255 9:132321689-132321711 CACACCCGGCTAATTTTTGTGGG - Intronic
1061827033 9:133264909-133264931 CACATCTAGCTGATTTTTTGTGG + Intronic
1061870819 9:133519401-133519423 GACACCCACCGAATTTTTTGTGG - Intronic
1185840646 X:3386948-3386970 CACACCAGGCTAATTTTTGGGGG + Intergenic
1186016797 X:5204755-5204777 CACACACACGTAATTCTGTGAGG - Intergenic
1186459531 X:9737164-9737186 CACACCCTGCTAATTTTCTTTGG - Intronic
1187009749 X:15267255-15267277 CACGCCTGGCTAATTTTTTGGGG - Intronic
1187520905 X:20013045-20013067 CACACTCACCCATTTTGTTGGGG + Exonic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1188117874 X:26267430-26267452 CACACCCAGCTAATTGTTTTTGG - Intergenic
1188674204 X:32918505-32918527 CACACACAGCTAATTTTTGTGGG + Intronic
1189193458 X:39132177-39132199 CACACCCACCTACTATGTTTAGG - Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1189376178 X:40467801-40467823 CATACCCGGCTAATTTTTTTTGG + Intergenic
1189440551 X:41031915-41031937 CACACCTGGCTAATTTTTTTTGG - Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190158819 X:48015862-48015884 CACACCCAGCTAATATTTTCTGG - Intronic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190174518 X:48138141-48138163 CACACCCAGCTAATATTTTCTGG - Intergenic
1190210536 X:48443368-48443390 CACACCCCACTAACTTTTTTAGG + Intergenic
1191603378 X:63034661-63034683 TACACCCAGCTAATTTTTTTTGG - Intergenic
1192783714 X:74318441-74318463 CCCACCCAGCTAATTTTTGTGGG - Intergenic
1193107894 X:77699288-77699310 CACACCTGGCTAATTTTTTGTGG + Intronic
1193529457 X:82638796-82638818 CACACCTGGCTAATTTTTTGGGG + Intergenic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1194371833 X:93083235-93083257 CACACACAGCTAAATTTTTTTGG + Intergenic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1196789793 X:119453688-119453710 CACACCTAGCTAATTTTTTGGGG + Exonic
1197859579 X:130956238-130956260 CACGCCCGGCTAATTTTTTGTGG - Intergenic
1198207204 X:134478260-134478282 CACACCCATCTATTTTTTTTTGG + Intronic
1198261772 X:134971131-134971153 CACACCCAGCTTTTTTTTGGGGG - Intergenic
1198462457 X:136876862-136876884 CACACCCAGCTAATTTTTGGTGG + Intronic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199255126 X:145710708-145710730 CACACCCAGCTGAATTTTTTTGG - Intergenic
1199756278 X:150867923-150867945 CACGCCCAGCTAATTTTTGTAGG - Intronic
1200679876 Y:6197269-6197291 CACACACAGCTAAATTTTTTTGG + Intergenic
1201055488 Y:9985979-9986001 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1201497194 Y:14601256-14601278 CTCGCCCACCTAATTTTTGGTGG + Intronic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic