ID: 1187527385

View in Genome Browser
Species Human (GRCh38)
Location X:20066375-20066397
Sequence CAGTGTAGGCAGTGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187527373_1187527385 17 Left 1187527373 X:20066335-20066357 CCTGCTGCTGTCCAGGAGGGAGG 0: 1
1: 0
2: 4
3: 49
4: 419
Right 1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG 0: 1
1: 0
2: 5
3: 34
4: 322
1187527378_1187527385 -6 Left 1187527378 X:20066358-20066380 CCTGAAGGCCTGGCCCACAGTGT 0: 1
1: 0
2: 1
3: 21
4: 292
Right 1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG 0: 1
1: 0
2: 5
3: 34
4: 322
1187527376_1187527385 6 Left 1187527376 X:20066346-20066368 CCAGGAGGGAGGCCTGAAGGCCT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG 0: 1
1: 0
2: 5
3: 34
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187527385 Original CRISPR CAGTGTAGGCAGTGGGAATG AGG Intronic
900588327 1:3444829-3444851 CAGTGTAGGTCGCGGGAAGGCGG - Intergenic
901068130 1:6504312-6504334 TGGTGGAGGCAGTGGGGATGCGG - Intronic
903275033 1:22216188-22216210 TAGGCAAGGCAGTGGGAATGGGG + Intergenic
903889540 1:26560459-26560481 CAGTGTAGGGAGTGGGAAACAGG - Intronic
904232148 1:29084166-29084188 CAGAGATGGCAGTGGGAATAGGG - Intronic
904503621 1:30933168-30933190 CAGTGAGGTCAGCGGGAATGAGG + Exonic
904988418 1:34572250-34572272 CAGTGGAGGAAGTGAGAAAGAGG + Intergenic
905794898 1:40810232-40810254 ATGTGCAAGCAGTGGGAATGTGG - Intronic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
908790497 1:67776216-67776238 CAGTGCTGGCAGTCAGAATGGGG + Intronic
909914647 1:81302077-81302099 CATTGTAGCCAGTGGGGGTGAGG + Intergenic
910227974 1:84955721-84955743 CAGTGGTGGCAGTGAAAATGGGG + Intronic
912138517 1:106692065-106692087 CAGGGTAAGGAGGGGGAATGAGG + Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
915428115 1:155843912-155843934 CAGGGTTGGGAGTGGGTATGGGG - Intronic
915589511 1:156862589-156862611 CTGTGCAGGCAGTGGGGAGGGGG - Intronic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
917417055 1:174821230-174821252 CAGTGCAGGTAGCGGGAATGAGG + Intronic
917450231 1:175141823-175141845 GAGTGTAGAGAGTGAGAATGAGG - Intronic
917727559 1:177841949-177841971 GAGAGTACGCAGTGGGGATGGGG + Intergenic
918471495 1:184880324-184880346 CAGTGTAGGCAGTGGATGAGAGG - Intronic
918719968 1:187840324-187840346 CTGTCTAGGCAGTGAGAAAGGGG + Intergenic
919453912 1:197801141-197801163 CAGAGTGGGCACTGGGAGTGGGG - Intergenic
922244049 1:223777526-223777548 CAGTGGAGCCACTGGGGATGTGG - Intergenic
922323275 1:224506234-224506256 GAGTGTAAGGAATGGGAATGTGG - Intronic
923115707 1:230935664-230935686 CAGTGTAGGCAGTGAGGACTGGG + Intronic
1063194607 10:3729720-3729742 CAGTGGAGCCCGTGGGGATGGGG + Intergenic
1064781611 10:18845537-18845559 CAGTGCAGGAAGCAGGAATGCGG + Intergenic
1066044671 10:31584688-31584710 CAGCGATGGCATTGGGAATGGGG + Intergenic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1067693629 10:48520114-48520136 CAGAAGAGGCAGTGGGAGTGCGG + Intronic
1068514064 10:58004471-58004493 CAGCGTAGGGGTTGGGAATGGGG - Intergenic
1068526242 10:58133604-58133626 CAGTGTAGGCAATGGGAGTGAGG + Intergenic
1069583542 10:69581417-69581439 GAGTGTGGGCAGTGGGTAGGGGG - Intergenic
1069643770 10:69975754-69975776 CATTGTTGCCAGTGAGAATGTGG - Intergenic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1070523061 10:77271215-77271237 CAGTGTAGCCAGTGCAACTGAGG - Intronic
1071194653 10:83143774-83143796 CAGTTTAATCAGTCGGAATGAGG - Intergenic
1071383513 10:85096539-85096561 CAGTGAAATCAGTGAGAATGTGG - Intergenic
1073291384 10:102414936-102414958 CAGCCTCGGCAGTGGCAATGAGG - Exonic
1074362252 10:112832889-112832911 CAGGGTAGGCAGTGGGGCTTTGG + Intergenic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1075187204 10:120273872-120273894 AGGTGGAGGCAGTGGGCATGCGG - Intergenic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1077233766 11:1470219-1470241 CAGTGGGGGCAGTGGGGATGGGG - Exonic
1077903345 11:6508836-6508858 CAGTGAAGGCCCTGGGAACGTGG - Intronic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078602850 11:12748857-12748879 CAGGGGAGGCAGGGGGACTGGGG + Intronic
1079145922 11:17851856-17851878 CTGTGTAAGCAGTGGGGGTGGGG - Intronic
1079652538 11:22947666-22947688 CTGAGTAGGGAGTGGGAATGGGG - Intergenic
1080924025 11:36737424-36737446 CAGTGTAGGAACTGTGAATTGGG + Intergenic
1081693004 11:45090789-45090811 CAGGGTAGGGAGTGTGAATGAGG + Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1083087945 11:60169327-60169349 GATTGTAGGCAGTTGGAACGTGG + Intergenic
1083176303 11:60952083-60952105 GAGTGTAGGCAGTGGGGGTGAGG - Intronic
1083185892 11:61017781-61017803 CAGGGTTGGCAGTTGGGATGTGG - Exonic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1086127483 11:83364179-83364201 CATTGTATGCACTGGGAATATGG + Intergenic
1086262899 11:84961941-84961963 CAGAGATGGCAGTGGGAGTGGGG - Intronic
1088634080 11:111802513-111802535 CGGAGACGGCAGTGGGAATGAGG + Intronic
1089173163 11:116529430-116529452 CAGTGAAGACATTGGGGATGTGG + Intergenic
1089696511 11:120219220-120219242 CTGTGGAGGGAATGGGAATGTGG + Intronic
1091069757 11:132551903-132551925 CTGTCTAGGCAGTGGGCAAGGGG + Intronic
1091118670 11:133039030-133039052 CAGCATAGGAAGTGGGAATGGGG - Intronic
1091715605 12:2774238-2774260 CTGTAGAGGGAGTGGGAATGGGG - Intergenic
1092003682 12:5051236-5051258 CAGTATAGGCAATGGAAATGTGG + Intergenic
1093218019 12:16385301-16385323 CATTGTAATCAGTGTGAATGGGG + Intronic
1093300654 12:17450475-17450497 CAGTGGAGGTAGCAGGAATGAGG - Intergenic
1093304753 12:17501280-17501302 TAGTCTGGGCAGTGAGAATGGGG - Intergenic
1093735874 12:22619606-22619628 TATTGTAGGCAGTGGAAATGTGG + Intergenic
1094376781 12:29798907-29798929 TAGTGTAAGCACTGGGAAAGTGG - Intergenic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1102205508 12:111088111-111088133 CAGGGAATGGAGTGGGAATGGGG + Intronic
1102972928 12:117185013-117185035 CAATGTAAACAGAGGGAATGGGG + Intronic
1103510820 12:121472715-121472737 CAGCAAAGGCATTGGGAATGGGG - Intronic
1103568468 12:121829066-121829088 CAAGGGAGGCAGTGGGCATGGGG + Intronic
1105014011 12:132774993-132775015 CTGTGTAGTCAGTGGTAATGGGG - Intronic
1107696027 13:43001112-43001134 CAATGTAGCCAGTGAGAAGGGGG + Intergenic
1107853371 13:44591817-44591839 CAGAGTAGGCCCTGGGAGTGGGG - Intergenic
1108284343 13:48891254-48891276 CACTGCAGGCAGTGGAGATGAGG + Intergenic
1109348393 13:61145202-61145224 CAAAGTGGGCACTGGGAATGGGG - Intergenic
1109986676 13:69995187-69995209 TAGTGTAGGCCTTGGGAGTGTGG - Intronic
1110363524 13:74656031-74656053 AAGTGTATGAATTGGGAATGAGG - Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1111000748 13:82177189-82177211 CAGAGAAGGGTGTGGGAATGGGG + Intergenic
1111843023 13:93473430-93473452 CGGAGCAGGCACTGGGAATGGGG + Intronic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1114380193 14:22194854-22194876 CAGTGAAGGCAATGGGGACGGGG + Intergenic
1115372746 14:32636953-32636975 CAGGGAAGGCAGTGAGAAGGTGG + Intronic
1115835440 14:37397366-37397388 CAGTGGAGGTGGTGGGAGTGGGG + Intronic
1116076955 14:40122941-40122963 TACTGTAGGCAGTGGGAAAGAGG + Intergenic
1116159817 14:41253871-41253893 CAGAGCAGGCACTGGGAGTGAGG + Intergenic
1117591515 14:57273458-57273480 GAGTGGAGGCAGAAGGAATGAGG + Intronic
1118049046 14:62005890-62005912 CTGTGGTGGCAGTGGGAATTGGG + Intronic
1118634562 14:67735686-67735708 TAGTGAAGGCAGTGGAACTGGGG - Intronic
1118975992 14:70677109-70677131 CAGTGCAGAGAGGGGGAATGTGG - Intergenic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120764473 14:88316112-88316134 CATTGGAGGTAGTGGGGATGAGG - Intronic
1121215630 14:92245491-92245513 CAGTAAAGGCCGTGGGGATGAGG - Intergenic
1122391070 14:101385016-101385038 CAGTGCAGACAGTGGGGAGGAGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1126208749 15:46075955-46075977 CAGGGAAGGCAGTGTGAGTGTGG + Intergenic
1126974868 15:54165117-54165139 CACTGTTGGAAGTGGGAAAGGGG - Intronic
1127281913 15:57500096-57500118 GGGTGTGGGGAGTGGGAATGGGG + Intronic
1128752401 15:70158873-70158895 GAGAGGAGGCAGTGGGACTGTGG + Intergenic
1129719051 15:77867932-77867954 CAGTGGTGGCAGTGGCAGTGTGG + Intergenic
1132022035 15:98371120-98371142 CAGAATGGGCAGTGGGAATGAGG - Intergenic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1133912041 16:10075039-10075061 CAGTGTAGGCATTGAGAATGTGG + Intronic
1134022399 16:10930100-10930122 CAGAGAAGGCAGTGGGAAACGGG - Exonic
1134126876 16:11622098-11622120 GGGTGGAGGCAGTGGGGATGTGG + Intronic
1134332387 16:13263093-13263115 GAGTGAAGGCTCTGGGAATGGGG - Intergenic
1134837718 16:17376046-17376068 CAGAGAAGGAAGTGGGACTGTGG + Intronic
1137369152 16:47888551-47888573 AGATGTAGGAAGTGGGAATGAGG - Intergenic
1137579062 16:49622352-49622374 CATTGTGGGGAGTGAGAATGGGG - Intronic
1137938417 16:52657807-52657829 TAGTGTTTGCAGTGGCAATGGGG - Intergenic
1138214975 16:55196314-55196336 GAGGGAAGGAAGTGGGAATGTGG + Intergenic
1138984081 16:62305620-62305642 GACTGTGGGCAGAGGGAATGGGG + Intergenic
1140589137 16:76330469-76330491 CAGTATAGGCAATGGAGATGGGG - Intronic
1142044644 16:87917977-87917999 CAGTGTCGGGACTGGGACTGTGG - Intronic
1142314404 16:89334537-89334559 CCATGTGGGCAGTGGGCATGCGG + Intronic
1142551948 17:746284-746306 CAGGGAAGGCAGTGAGAATCTGG + Exonic
1143114927 17:4576925-4576947 CAGAGTGGGCAGTGGGGGTGGGG - Intergenic
1143856833 17:9857582-9857604 CAGTGTAAACAGTGGGGAAGGGG - Intronic
1144493130 17:15731592-15731614 CAGTGGGGTCAGTGGGAACGTGG + Intergenic
1144907125 17:18645060-18645082 CAGTGGGGTCAGTGGGAACGTGG - Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1146458239 17:33023824-33023846 CATGGTAGGCAGGGGGAAGGGGG - Intronic
1147350693 17:39840858-39840880 CAGGGTAGGCAGTGTGAATGAGG + Intronic
1147491110 17:40867057-40867079 CAGTGTTGGAAGTGGTTATGGGG - Exonic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1148208900 17:45796386-45796408 CAGAGCTGGCAGTGGGAACGAGG - Intronic
1149380814 17:56092239-56092261 CAATGTAGGCACAGGGAGTGAGG + Intergenic
1150285143 17:63950061-63950083 CAGTGTTGGGAGCGGGAGTGGGG + Intronic
1150430228 17:65109467-65109489 CAGTTCAGGCAGAGGCAATGAGG - Intergenic
1150711335 17:67533012-67533034 CAGTGGAGGCAGTGGGTGTCTGG + Intronic
1151388972 17:73772837-73772859 CAGTGGAGGCAGTGGGGCAGTGG - Intergenic
1151532714 17:74717271-74717293 CAGTGTATGGAATGGGAATCTGG + Intronic
1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG + Intronic
1152047170 17:77944779-77944801 CAGTTGATGCACTGGGAATGAGG - Intergenic
1153062913 18:1012608-1012630 AATTGTGGGCAGTGTGAATGGGG + Intergenic
1153803834 18:8694862-8694884 CAGTGTTGGAAGTGGGCCTGGGG + Intergenic
1157016021 18:43714513-43714535 CATTGTAGGCTGTTGGCATGGGG + Intergenic
1159300661 18:66562124-66562146 CAGGGTGGGGAGTGGGCATGGGG + Intronic
1159732316 18:72044192-72044214 CCGATTAGGCAGTCGGAATGGGG + Intergenic
1160405141 18:78640163-78640185 CAGTGTAGACAGCTGGGATGGGG + Intergenic
1160471802 18:79141829-79141851 AAGTGTAGGCTGTTAGAATGTGG + Intronic
1160584205 18:79903803-79903825 CAGGGTGGGCAGTGGGGGTGGGG - Exonic
1161483678 19:4523629-4523651 CAGGGACGGGAGTGGGAATGGGG - Exonic
1164574680 19:29398829-29398851 CTGTCTGGGCAGTGGGATTGGGG - Intergenic
1164711423 19:30359627-30359649 CAATGTCGGCAGTGGGGATGAGG + Intronic
1165145164 19:33725909-33725931 CACTGGAGACACTGGGAATGGGG + Intronic
1165226659 19:34359730-34359752 GAGTGAAGGCAGAGGGACTGGGG - Intronic
1165258106 19:34592188-34592210 CATTTTGGGCAGTGGGAGTGAGG + Intergenic
1165474975 19:36025179-36025201 GGGTGTAGGCAGTAGGGATGAGG + Intronic
1165951615 19:39476713-39476735 GTGTGTATGCCGTGGGAATGAGG + Intergenic
1165986534 19:39774272-39774294 CATTTCAGGCAGTGAGAATGGGG + Intergenic
1166091171 19:40510044-40510066 CAGTGTGGGGAGTGCGAGTGTGG + Intronic
1166699166 19:44872175-44872197 CAGTGTAGGCAGTTTTGATGGGG - Intronic
1168426117 19:56240410-56240432 CAGTGCAGGAACTGGAAATGGGG + Exonic
925995042 2:9285349-9285371 CAGTGTTTGAAGTGGGGATGGGG - Intronic
927526793 2:23750729-23750751 CAGTCTAGGCAGTTGCAATGAGG - Exonic
928087515 2:28355290-28355312 GGGTGTGGGCAGAGGGAATGGGG - Intergenic
928250308 2:29671587-29671609 CAGTGTAGAAATTGTGAATGAGG + Intronic
930990710 2:57650672-57650694 CAGTGTAGACAGAGGCAATGGGG + Intergenic
931433550 2:62229016-62229038 CAGTGTAGGAAGTGGCCTTGTGG - Intergenic
931893776 2:66705619-66705641 CAGTGTAGTGAGTGGTTATGAGG + Intergenic
931963810 2:67510943-67510965 CAGTGGAGGTAGGGGGTATGGGG + Intergenic
932100604 2:68896325-68896347 CAGTGTAGGTGGTGGGAGCGTGG + Intergenic
932141091 2:69278839-69278861 CAGTGGTGGCAGTTGGAAGGGGG + Intergenic
932291406 2:70583149-70583171 CAGTGGAGGCAGGGAGAATTCGG - Intergenic
932356062 2:71069084-71069106 CAGGGTGGGGAGTGGGAGTGGGG + Intronic
932481271 2:72040838-72040860 CAGTGTAGGCAGTGGTGTGGAGG - Intergenic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
932777702 2:74538197-74538219 CATTGTAGACAACGGGAATGAGG - Intronic
933187313 2:79292233-79292255 CAGTGTTGGCTGTGGCAGTGAGG + Intronic
935350207 2:102145902-102145924 TCCTGTAGGCAGTGGGAAAGAGG + Intronic
937289604 2:120774104-120774126 CATTGGAGGCAGTGTGGATGCGG + Intronic
937317419 2:120940810-120940832 CAGAGTAGACCTTGGGAATGTGG + Intronic
938186059 2:129232987-129233009 CAGGGTAGGTAGTGGGTGTGGGG - Intergenic
938229319 2:129644936-129644958 CTATGAAGGCAGTGGGTATGAGG + Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941241619 2:163045757-163045779 CAGAGGAGGCAATGGGCATGTGG - Intergenic
942985607 2:182137540-182137562 CGTTTTAGGCAGTAGGAATGAGG - Intergenic
943427072 2:187750275-187750297 CAGAGTCGGCACTGGGAGTGGGG + Intergenic
945462380 2:210124487-210124509 CAGTGAAGGCAGTGCTAAGGGGG + Intronic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946803038 2:223441708-223441730 CAGAGTTGGGAGAGGGAATGGGG + Intergenic
947173425 2:227336004-227336026 TAGACTAGGCAGTGTGAATGAGG + Intronic
947776806 2:232718831-232718853 GTAGGTAGGCAGTGGGAATGGGG + Intronic
947959074 2:234219581-234219603 CTGGGGAGGCAGTGGAAATGTGG - Intergenic
948949091 2:241237206-241237228 CAGGAGAGGCAGTGGGAAGGGGG + Intronic
1169472751 20:5902253-5902275 CAGTTTTGGCAGTGGGGTTGTGG - Intergenic
1170315021 20:15032121-15032143 CAGAGTGGGCACTGGGAGTGAGG + Intronic
1170452493 20:16498717-16498739 TACTGTAGGCAGTGGGCATAAGG - Intronic
1170703150 20:18722226-18722248 CACTGTAGTCTGTGGGCATGGGG + Intronic
1170980971 20:21212815-21212837 CTGTGTAGGCAGTTGGGATGGGG + Intronic
1172173939 20:32961103-32961125 CAGAGTGGGGAGCGGGAATGGGG - Intronic
1172658381 20:36550241-36550263 CAGGGTTGGAGGTGGGAATGAGG + Exonic
1172916615 20:38448131-38448153 TAGTGCAGGCAGAGGAAATGCGG + Intergenic
1174499686 20:50975601-50975623 GTGTGCAGGCAGTGGGATTGGGG - Intergenic
1175546203 20:59779475-59779497 CAGGCGAGACAGTGGGAATGGGG - Intronic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1179376396 21:40853306-40853328 CAGTGATGGCAGTGGGAGGGTGG - Intergenic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180726154 22:17948170-17948192 CAGGGCAGGCAGTGGGAGTGGGG - Intronic
1180977492 22:19856301-19856323 CAGAGTGGGCAGTGGGCCTGTGG + Intergenic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1183256141 22:36763706-36763728 CAGTCTAGGAAACGGGAATGAGG - Intronic
1183450807 22:37893907-37893929 CAGTGTCGGCAGCAGGCATGAGG + Intergenic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1185393061 22:50573074-50573096 CAGGGTAAGCAGTGGGCACGTGG + Intronic
949268281 3:2185550-2185572 CAGTGTATGCTATGGGGATGAGG + Intronic
949405373 3:3708400-3708422 CAGTGTAGACAGTGTGCCTGGGG - Intronic
950893280 3:16424100-16424122 CAGTGTAGCCATGGGGACTGGGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953461685 3:43086374-43086396 CAGCTTAGGCAGTGGGGTTGTGG - Intronic
953551373 3:43906401-43906423 CAGGGTAGGCAGTGGCCAGGTGG - Intergenic
953677637 3:45015726-45015748 CAGTGAGGGTAGTGGGGATGAGG - Intronic
955091285 3:55753228-55753250 TAGTATTGGCAGTGGGATTGGGG - Intronic
955907843 3:63826358-63826380 TAGTCAGGGCAGTGGGAATGGGG + Intronic
955931166 3:64058270-64058292 CAGTTAAGGCAATGGGAATTAGG + Intergenic
956838132 3:73112555-73112577 CAGTGTTGGCCGTTGGAATCAGG - Intergenic
957682219 3:83451618-83451640 CATTGGAGGCGGTGGGCATGGGG - Intergenic
959419997 3:106117261-106117283 AAGGGGAGGCAGTGGGAAAGTGG + Intergenic
960041683 3:113156229-113156251 CAGGGCTGGGAGTGGGAATGGGG + Intergenic
960980043 3:123215436-123215458 CATTGTAGTCAGAGGGGATGAGG + Intronic
961364830 3:126392783-126392805 CAGCCCAGGCAGTGGGCATGTGG - Intergenic
961474380 3:127137567-127137589 CAGTGTGGACAGTGGGGGTGGGG - Intergenic
961768479 3:129230398-129230420 TAGGGCAGGCAGTGAGAATGTGG + Intergenic
962843538 3:139255864-139255886 AAGTGTTTGCAGTGGGAGTGAGG + Intronic
963914025 3:150841259-150841281 CAGTGTTGGGAGGGAGAATGTGG + Intergenic
965137890 3:164797565-164797587 AAGTGTTGTTAGTGGGAATGAGG - Intergenic
965206236 3:165721165-165721187 CAGAGTAGGCACTGGGGGTGGGG + Intergenic
965844917 3:172949986-172950008 TAGGGTAGGCAGTTGTAATGGGG - Intronic
966334645 3:178854505-178854527 CAGTGTAGGTAAAGGGATTGGGG + Intergenic
966868428 3:184275360-184275382 CAGTGTAGGCTGTGTGTGTGTGG + Intronic
967008263 3:185406038-185406060 CAGGGCTGTCAGTGGGAATGAGG + Intronic
968621470 4:1605185-1605207 CAGAGTAGGCGGTGGGGGTGGGG + Intergenic
968725888 4:2247644-2247666 CTGTGCAGGCAGTGGGGAGGGGG + Exonic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969427158 4:7131741-7131763 CAGTGTAGTGTGTGTGAATGTGG + Intergenic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
974581929 4:63814651-63814673 CAGTATGGGGAGTGAGAATGTGG + Intergenic
976811418 4:89104885-89104907 CACTGTAGGCAGTTGGGATATGG - Intronic
977685604 4:99843880-99843902 CAATGCAGGCATTGGAAATGGGG - Intronic
978459899 4:108940306-108940328 CAGTGTATTCAGTGGTAAAGAGG + Intronic
978770218 4:112448394-112448416 CAGAGTGTGCAATGGGAATGGGG - Intergenic
979288218 4:118950628-118950650 TAGAGGAGGCAGTGGGAATGTGG + Intronic
979603360 4:122609854-122609876 CAGTGGTGGCAGTGGGCATTGGG + Intergenic
982068025 4:151671814-151671836 CTGTGTGGGCAGGGGGAGTGAGG + Intronic
982128744 4:152207660-152207682 CAGTGCAGGCTGTGGGAATTAGG + Intergenic
985783086 5:1881086-1881108 CAGTGTGGGGAGCGGGGATGTGG + Intronic
986989674 5:13537060-13537082 CAGTCCAGGCACTGGGAATTAGG - Intergenic
990515061 5:56523211-56523233 CATTCTAGCCTGTGGGAATGTGG + Intronic
990866348 5:60384808-60384830 CAGTGTAGGCATTGGGGAAGAGG - Intronic
991963873 5:72072206-72072228 AAGTGGAGGGAGTGGGACTGGGG + Intergenic
992720898 5:79560282-79560304 GAGGGTAGGCTCTGGGAATGGGG + Intergenic
992751743 5:79868756-79868778 CAATGGTGGCAATGGGAATGCGG + Intergenic
993348062 5:86809992-86810014 CAGTGGAGGCAGTGGAATTGTGG - Intergenic
994406634 5:99352993-99353015 CAGAGTAGGAACTGGGAATGGGG + Intergenic
995723925 5:115165853-115165875 CAGAGTGGGCACTGGGAATGGGG - Intronic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996343645 5:122466425-122466447 CAGGGTTGGAAGTGGGGATGAGG + Intergenic
997178232 5:131800828-131800850 TACTGTAGGCACTGGGAATATGG + Intergenic
997211189 5:132077929-132077951 CAGTGGAGGCAATGGGCATCTGG - Intergenic
997503567 5:134397822-134397844 CAGTGTAGGCATTTGCAAAGTGG - Intergenic
997625050 5:135325947-135325969 AAGTGTAGCTAGTGTGAATGAGG + Intronic
997626375 5:135333937-135333959 CAGCCTCGGCAGAGGGAATGAGG + Exonic
1001106178 5:168856564-168856586 CAGTTTAGGCAAAGAGAATGAGG + Intronic
1001757931 5:174185326-174185348 CATTGTAGGTATTGGGAATGTGG + Intronic
1001877890 5:175216843-175216865 CAGTGGAGGCTGGGTGAATGGGG + Intergenic
1002290160 5:178194893-178194915 CAGTGGAGGAAATGGGAAGGAGG - Intergenic
1002978320 6:2109233-2109255 CAGTGAATGCAGTGGGCATGGGG - Intronic
1004583346 6:16975741-16975763 CAGTGTAGGAAGCTGGAGTGAGG - Intergenic
1006235132 6:32623841-32623863 CTGAGGAGGAAGTGGGAATGGGG - Intergenic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1009010950 6:57841616-57841638 CAGTAAAGGGTGTGGGAATGTGG - Intergenic
1009492196 6:64304861-64304883 CAGTGAAAGCAGTGGTAAGGGGG + Intronic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011993665 6:93557070-93557092 CAGTGTAGGTAGTGGTTAAGAGG + Intergenic
1013059718 6:106621424-106621446 TGTTGTAGTCAGTGGGAATGAGG - Exonic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013402817 6:109815412-109815434 CAGTGTAGGGAGTGAGAACCTGG - Intronic
1013634189 6:112012831-112012853 AAATGTAGGAAATGGGAATGTGG + Intergenic
1014018841 6:116565393-116565415 CAGTGTGGGCAGCGGGGATGGGG + Intergenic
1014579720 6:123122316-123122338 CAGGGTAGTCAGTGGAAATTGGG + Intergenic
1015924329 6:138294218-138294240 GAGTGTAAGCAATGGGAATGTGG - Intronic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1019050942 6:169183161-169183183 CGGTGTAGGCAGAGGGAACTCGG - Intergenic
1019460725 7:1157009-1157031 CCGTGGTGGCAGTGGTAATGTGG - Intronic
1021153206 7:17177041-17177063 CTGTGTAAGAAGTGGGAATTTGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1026960388 7:74404127-74404149 CAGTGGAGGCAGAGGGGATCCGG + Exonic
1028057411 7:86263527-86263549 CATTGGATGCTGTGGGAATGAGG + Intergenic
1029361658 7:100092629-100092651 CAGTATAGACACTGGGGATGCGG - Intergenic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1029910511 7:104141347-104141369 CAGTGGTGAGAGTGGGAATGAGG - Intronic
1030577853 7:111312471-111312493 TTGTGTTGGCAGTGGGAGTGGGG + Intronic
1031974908 7:128087407-128087429 CTGTATAGGCAGGAGGAATGTGG + Intronic
1033510042 7:142051350-142051372 CATTGTTGGGAGTGGGAGTGGGG + Intronic
1033512834 7:142077329-142077351 CATTGTTGGGAGTGGGAGTGGGG + Intronic
1034968784 7:155407042-155407064 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968808 7:155407117-155407139 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968843 7:155407241-155407263 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1036180425 8:6579873-6579895 CTGTGTGGGCAGTGTGACTGTGG - Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036294190 8:7522059-7522081 CAGTGCAGCCCGTGGGAAAGGGG + Intergenic
1036328372 8:7798932-7798954 CAGTGCAGCCCGTGGGAAAGGGG - Intergenic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038919190 8:32063947-32063969 AAGTGTGGGCAGGGAGAATGTGG + Intronic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040632345 8:49230176-49230198 CAGAGTAGGGAGTGTGAGTGTGG + Intergenic
1044265583 8:90177621-90177643 CAGTGTGGTCAATGGGAACGAGG + Intergenic
1044277767 8:90322126-90322148 CAGTGGAGTCAGTGGGCAGGAGG + Intergenic
1046240998 8:111492292-111492314 TAGTGTAGCCAATGTGAATGTGG - Intergenic
1046915429 8:119673568-119673590 CACTGTCGGGGGTGGGAATGTGG - Intergenic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1049287189 8:141782243-141782265 CAGTGTTGCCAGTGCCAATGTGG + Intergenic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1052038246 9:23707584-23707606 CACAGGAGGCAGTGGAAATGTGG + Intronic
1052113962 9:24625951-24625973 CAGTGTATACAGTTGGAAAGGGG + Intergenic
1054337801 9:63823126-63823148 GGGTGTGGGCAGTGGGTATGGGG - Intergenic
1056760000 9:89407730-89407752 CAGTGGAGGGAGTGTGGATGAGG - Intronic
1056880198 9:90384321-90384343 CAATATAGACAGTGTGAATGTGG + Intergenic
1057015123 9:91644589-91644611 CAGTGGAGGCTGGGGGACTGTGG + Intronic
1057416146 9:94863796-94863818 CATTGTAGGCAGCAGGAAGGAGG + Intronic
1057417614 9:94878820-94878842 CTGTCTAGGCAGTGGGCAAGGGG - Intronic
1058040087 9:100293636-100293658 CATAGTAGGCACTGGGAGTGGGG + Intronic
1058149096 9:101444269-101444291 CAGTTAGGGCAGAGGGAATGGGG + Intergenic
1060407945 9:123381969-123381991 GAGTGGTGGCTGTGGGAATGGGG + Exonic
1060434637 9:123582997-123583019 CAGTGTAGAAAGTTGGAAGGTGG - Intronic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1185835048 X:3337830-3337852 GAGTGGTGGGAGTGGGAATGAGG + Intronic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1187779309 X:22799830-22799852 CAGGGTAGGTATTGGGAATAGGG + Intergenic
1188649385 X:32612591-32612613 CAGTGTAGGCCAAGGGAAAGAGG + Intronic
1188689025 X:33106280-33106302 AAGTGGAGGGGGTGGGAATGAGG + Intronic
1189888781 X:45577339-45577361 CACTGGAGGCAGTGGCAGTGTGG + Intergenic
1190907841 X:54746143-54746165 CTGTGGTGGCAGTGGGCATGGGG - Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1193352268 X:80477370-80477392 CAGTGCATGCAGAGGGACTGTGG + Intergenic
1193458086 X:81755384-81755406 CAGTCCAGGCAGTCTGAATGAGG + Intergenic
1193593631 X:83419887-83419909 CTGTGTTGGGGGTGGGAATGGGG - Intergenic
1193771594 X:85593858-85593880 CAGTGGAGGTAATGGGACTGAGG - Intergenic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1195831247 X:109061180-109061202 AAGAGTAGGAAGTGGGAATGTGG + Intergenic
1198601738 X:138291503-138291525 CAGTGAAGCCAGTGGGAACTGGG + Intergenic
1198840689 X:140854174-140854196 CATTGAAGGCAGGAGGAATGTGG + Intergenic
1198861855 X:141079469-141079491 CAGTGGAGGTTGTGGAAATGTGG - Intergenic
1198900835 X:141507903-141507925 CAGTGGAGGTTGTGGAAATGTGG + Intergenic
1199825186 X:151491622-151491644 CAGGGATGGGAGTGGGAATGAGG - Intergenic
1200006114 X:153085461-153085483 TAGTGTAGGCATTGGGAAGTGGG + Intergenic