ID: 1187527421

View in Genome Browser
Species Human (GRCh38)
Location X:20066714-20066736
Sequence GGGTTTAAACAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187527421 Original CRISPR GGGTTTAAACAGATGGAGCA GGG (reversed) Intronic
902688619 1:18095581-18095603 GGGTTGGAACAGATAGAGGATGG - Intergenic
902741064 1:18438345-18438367 AGGGTTAAACACATGGATCAAGG - Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904486057 1:30825087-30825109 GGATTAAAATAGAGGGAGCACGG + Intergenic
906561798 1:46763697-46763719 GGCTTTACACAGAGGGAGCCTGG - Intronic
906571226 1:46843144-46843166 GGGTTTCACCAGATCCAGCAAGG + Intergenic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
908178494 1:61579979-61580001 GGATTTTAACAGTTGGACCAGGG - Intergenic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
917071569 1:171157070-171157092 GGGTTTCAAGATATGGATCATGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922137875 1:222850331-222850353 GGGTTTAAAAAGAGAGAACAAGG - Intergenic
923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG + Intergenic
924932716 1:248745047-248745069 GGGTTAACACAGAAGGACCAGGG - Intronic
1065400299 10:25292567-25292589 GGGAGTAAACAGTTGGAGAATGG + Intronic
1066538072 10:36412904-36412926 TACTTTAAACAGATGGTGCATGG - Intergenic
1067157664 10:43795615-43795637 TGGTTTAACAAGAAGGAGCAGGG + Intergenic
1067990466 10:51206032-51206054 TGTTTTAAACAGAAGCAGCAGGG + Intronic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1071180964 10:82983054-82983076 GGGTCTAAACAGTTGGAAAAAGG - Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1072761504 10:98060670-98060692 GGGTTTTAAAAGATGGAGAGAGG + Intergenic
1075746854 10:124733995-124734017 GAGTTTAGACAGATGAAGAACGG - Intronic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1076338647 10:129727884-129727906 GGATTTGAACACATGGAGTAAGG + Intronic
1076934837 10:133560451-133560473 GGGTATAAAAAACTGGAGCAAGG + Intronic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1089115828 11:116094310-116094332 GGGTTTCAACATATGGATTAGGG - Intergenic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1095743994 12:45636995-45637017 GGTTTTCAACAGATGGTGCTGGG + Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098720500 12:73891794-73891816 GGGTGTAAGCAGATGTAGGAGGG - Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112857999 13:103794385-103794407 TGCTTCTAACAGATGGAGCAGGG - Intergenic
1113274425 13:108712718-108712740 GGTTCTTACCAGATGGAGCAGGG - Exonic
1113584303 13:111452943-111452965 AGGTTTAAAAGGATGGAGAATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114544400 14:23487752-23487774 AGGTATAAAGAGATGGAGAAGGG + Intronic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1118230217 14:63940723-63940745 GGGTCAAAACAGAAGGAGTAGGG - Intronic
1119527219 14:75332444-75332466 GGGATTAAGCAGATGGGACATGG - Intergenic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1126238095 15:46409111-46409133 GGATTTCAACATATGGAGAAAGG - Intergenic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG + Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1139130437 16:64136253-64136275 GGGTTTGAACAGAGGAAGTAGGG + Intergenic
1139208243 16:65050322-65050344 GGCTTTAAACAAATGTGGCATGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1148020851 17:44552511-44552533 GGGGTGAAATAGATGGAGTAGGG - Intergenic
1150988553 17:70227899-70227921 GGGTTCAAATAGAAGGAGTAAGG + Intergenic
1152925796 17:83087243-83087265 CGGTTTAAGCAGATGCCGCAGGG - Intronic
1153236653 18:2994846-2994868 TGGTTTAAACAGATGGTATATGG + Intronic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG + Intergenic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
1168582466 19:57566948-57566970 TGCTGTTAACAGATGGAGCATGG + Intergenic
926372583 2:12194971-12194993 GGGATTTCCCAGATGGAGCAGGG + Intergenic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
929229289 2:39542616-39542638 GCCTTAAACCAGATGGAGCATGG + Intergenic
930013244 2:46953961-46953983 GGGTCTCAAGAGATGGAGCTTGG - Intronic
932029298 2:68166907-68166929 GGGTTTCAAGATATGGATCACGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
940692744 2:156939793-156939815 GAATTTAAACTGAGGGAGCATGG - Intergenic
942786337 2:179706668-179706690 GGGTTGAAACTGACTGAGCAAGG + Intronic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
944930962 2:204518672-204518694 GGGTTTAAAGATAACGAGCAAGG + Intergenic
948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG + Intergenic
1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG + Intergenic
1172343759 20:34180298-34180320 GGGTTTGATCAGATAGATCAGGG + Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1182111792 22:27728952-27728974 GAGTTTCAACAGCTGGAGAAAGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
957979965 3:87496026-87496048 GGGTTTAAAGATATGGATCTTGG - Intergenic
960397703 3:117157146-117157168 AGGTGTAAATAGATGGAGAAAGG + Intergenic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962775740 3:138657947-138657969 GGCTATAAACAGAGGGAGAAGGG - Intronic
963747590 3:149141268-149141290 GGGTTTAAAAAGACAGAGAAAGG - Intronic
964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG + Intergenic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
965120681 3:164551481-164551503 GGGGTTAAACAGATGAAGAGTGG + Intergenic
966986023 3:185181074-185181096 GGGTTGATACAGATGTAACAGGG - Intergenic
967302762 3:188031932-188031954 GGACTTAGACAGATGGGGCAGGG - Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
975366058 4:73529152-73529174 GTGTTTCAACAAATAGAGCATGG - Intergenic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
980601025 4:135024921-135024943 GGGATTAATCAGATGAAGAAGGG - Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
984419900 4:179507577-179507599 GGGTTTCAAGATATGGATCATGG - Intergenic
984820194 4:183875336-183875358 GGGTTTTAGAAGATGGGGCAGGG + Intronic
985507605 5:292798-292820 GGATTTAAACAGAGGAACCATGG + Intronic
985740368 5:1612331-1612353 GGATTTAAACAGAGGAACCATGG - Intergenic
994279110 5:97878754-97878776 TGGTTTAAGAAAATGGAGCACGG + Intergenic
994513031 5:100731981-100732003 GTGTTTAAACAGAAAGTGCAAGG + Intergenic
994689838 5:103004064-103004086 GTGCTTAAGCAGATGGAGAAGGG - Intronic
997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG + Intronic
997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG + Intergenic
1000765349 5:165282676-165282698 GGGTCTAACCAGATGTAGCCTGG - Intergenic
1002539400 5:179896051-179896073 GGGATGAAACCGATGGAGTAAGG - Intronic
1004111179 6:12720475-12720497 GGTTTTCAGCAGATGGAGCTGGG + Intronic
1007492061 6:42230830-42230852 GGGCTTAATCAGACGCAGCATGG + Intronic
1008119959 6:47602023-47602045 GGGTTTAAAACAATGGAGGAGGG - Intronic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG + Intergenic
1013504186 6:110782744-110782766 GTGTTTAACCTGATGGAGAAAGG - Intronic
1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG + Intergenic
1018016048 6:159713297-159713319 GGGTTTGAAAAGATGAGGCAGGG - Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1021958948 7:25853116-25853138 GTGTTTAAACAAATGGAGATGGG - Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1041941028 8:63388059-63388081 GGGTTTAGATAAATGGACCAAGG - Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG + Intergenic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1050455025 9:5826289-5826311 GGGTTTACACATTTGAAGCAGGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1058167593 9:101637444-101637466 GGCTGTAAAAATATGGAGCATGG + Intronic
1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG + Intergenic
1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG + Intergenic
1193878044 X:86886323-86886345 GGGTTTAAACAAATGTATAAGGG - Intergenic
1194239297 X:91423895-91423917 GGCTTTAATCAAATGGAGCCTGG + Intergenic
1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG + Intergenic
1196875105 X:120149555-120149577 GGGCCTAAAAAGATGGAGCCTGG - Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic