ID: 1187529579

View in Genome Browser
Species Human (GRCh38)
Location X:20084299-20084321
Sequence AGGTGTATACACTGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187529579_1187529582 2 Left 1187529579 X:20084299-20084321 CCTTCTTCACAGTGTATACACCT 0: 1
1: 0
2: 4
3: 20
4: 172
Right 1187529582 X:20084324-20084346 GTTCATGCCACATCAATATACGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187529579 Original CRISPR AGGTGTATACACTGTGAAGA AGG (reversed) Intronic
901248392 1:7752310-7752332 AGATGTATACAATCTGAAGGGGG - Intronic
904648985 1:31990053-31990075 AGCTGAAGATACTGTGAAGAAGG - Intergenic
905176397 1:36138381-36138403 ATGTGTATTCACTTTCAAGAAGG - Intronic
905607030 1:39310427-39310449 TGGTGTGTGCACTGGGAAGAGGG + Exonic
906153250 1:43599984-43600006 TGCTGTACACACTGTGCAGAGGG + Intronic
906250972 1:44310823-44310845 TGGTGTACAGACTGTAAAGAGGG - Intronic
906643812 1:47458490-47458512 ATGTGCAGTCACTGTGAAGATGG - Intergenic
906973924 1:50548586-50548608 AGGTGGAAACACAGTGAAAAGGG - Intronic
907769475 1:57446198-57446220 TGGTGTATCTACAGTGAAGATGG - Intronic
907808487 1:57844785-57844807 AGATGTATACAGCCTGAAGAAGG - Intronic
909444445 1:75732744-75732766 AGGTATATACATTTTAAAGAGGG + Intronic
910900409 1:92114672-92114694 TGGTGTACAAACTGTGAGGAGGG + Intronic
911501210 1:98687621-98687643 TGGTGTTTTCACTCTGAAGAAGG + Intronic
913478199 1:119259317-119259339 AGCTGTAGAGGCTGTGAAGAAGG + Intergenic
913586528 1:120280043-120280065 GGATGTATTCACTGTGCAGAGGG + Intergenic
913621658 1:120618327-120618349 GGATGTATTCACTGTGCAGAGGG - Intergenic
915204793 1:154262057-154262079 GGGTGTATTCACTGAGTAGAAGG + Intronic
916961951 1:169897349-169897371 AGGTGAGGACACTGGGAAGAGGG - Intergenic
917826994 1:178833332-178833354 AGTTGTATTTACTGTGAATATGG - Intronic
918561982 1:185879998-185880020 AGCTGTATCCATTGTGAAGCAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920869204 1:209779568-209779590 AGGTATATAAACTGTGAAAAAGG + Exonic
921517985 1:216121055-216121077 AGGTGAACACAGTGAGAAGAGGG + Intronic
923334553 1:232956148-232956170 AGGTGTGGACACTTTGAACAGGG + Intronic
923783325 1:237044118-237044140 AGGTTTATACACCGTGACCAAGG - Intronic
924265104 1:242273792-242273814 AGGAGAAGACACTGTGAAGATGG + Intronic
924317982 1:242818233-242818255 AGGTGTATTCAGTATTAAGAGGG + Intergenic
1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957050 10:1547334-1547356 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957093 10:1547552-1547574 TGGTGTATACACTGTGGGGAGGG + Intronic
1062957135 10:1547771-1547793 TGGTGTATACACTGTGGGGAGGG + Intronic
1062957144 10:1547809-1547831 AGGTGTATACACTGTGGGGAGGG + Intronic
1066719708 10:38324698-38324720 AGGAGAAGACACTGTGAAGATGG - Intergenic
1068404086 10:56568099-56568121 ATGTTTATACAGTGTGAAAATGG - Intergenic
1069197125 10:65565630-65565652 AGATGTTTTCACTGTAAAGAAGG + Intergenic
1069466269 10:68642045-68642067 ATGTGTATACACTGTGTAATTGG + Intronic
1070339309 10:75482111-75482133 AGGAGTATACACTCTGAGGGAGG - Intronic
1072382060 10:94882982-94883004 AGGTATATTCTCTGTGAAGGTGG - Intergenic
1072818264 10:98530901-98530923 AGGTCTGGACCCTGTGAAGAAGG + Intronic
1074242598 10:111654134-111654156 GGGTGTATACACAGTGAGAAAGG - Intergenic
1075361721 10:121843002-121843024 AGGTGTATAGACTGGAAAGGAGG + Intronic
1075625138 10:123958581-123958603 ATGAGTATACTCTGTGAAGCTGG - Intergenic
1075928123 10:126269956-126269978 AGTTGTATAGACGTTGAAGAAGG - Intronic
1077815302 11:5681082-5681104 AGGTGTAGACATGGTGTAGAGGG + Intronic
1079916808 11:26379183-26379205 AGGTTTTTACAATGAGAAGATGG + Intronic
1083805196 11:65069345-65069367 AGGTGGACTCAGTGTGAAGAAGG - Intronic
1085901918 11:80710281-80710303 AGGTGACTACAATGTGAGGATGG + Intergenic
1086513599 11:87587518-87587540 ATGAGTTTATACTGTGAAGAAGG + Intergenic
1087940987 11:104096831-104096853 AGTTTTATACCCTTTGAAGAAGG - Intronic
1088715140 11:112542595-112542617 AAGTGTATACAGTATGAACATGG + Intergenic
1090511369 11:127378914-127378936 AGGTGCAGACACTTTGTAGACGG - Intergenic
1093823892 12:23657808-23657830 ATGTTTATACATTGTGAAGGAGG + Intronic
1095813992 12:46401371-46401393 AGGTGTGTACAATGTGCACATGG + Intergenic
1099580432 12:84439913-84439935 AAATGTATAAACTGTGAAAAAGG - Intergenic
1101527189 12:105542112-105542134 AGGTGTTAAGCCTGTGAAGAAGG + Intergenic
1102434178 12:112907832-112907854 AGCTGTCTCCACTGTGGAGAGGG + Intronic
1103285274 12:119795915-119795937 AGTTGTCTACACTGTGCAGAAGG + Intronic
1106332218 13:28749635-28749657 AGGTGTACACCCTGTGAGAATGG + Intergenic
1106701458 13:32233541-32233563 AAGTGTAGATACTGTGAAGAAGG - Intronic
1109181831 13:59223042-59223064 AGCTGTGTAGACTGTGAAGTAGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1111845987 13:93508997-93509019 AGGTGACTCCACTGGGAAGATGG + Intronic
1115439485 14:33415788-33415810 AAGGGTATACACTGTCAAGAAGG - Intronic
1115672640 14:35631592-35631614 AGAAGTTTACACTCTGAAGAAGG + Intronic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1117777635 14:59198889-59198911 ATGTGAATACACTGTGAATGAGG - Intronic
1118710749 14:68517450-68517472 AGATGTCAACACAGTGAAGAAGG + Intronic
1120569942 14:86105277-86105299 ACGTGTAGACACTGAGAACAAGG - Intergenic
1120775127 14:88426313-88426335 AGGTGTAGTCTCTCTGAAGAGGG - Exonic
1120798974 14:88668477-88668499 AGGTGAATACACTGAGAACCAGG + Intronic
1121246503 14:92464826-92464848 ATGTGAAGACACTGTTAAGATGG - Intronic
1126931588 15:53658551-53658573 AGGTATACACACAGAGAAGAGGG + Intronic
1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG + Intronic
1130243195 15:82217703-82217725 AGGTGTGAACACTGGGAAGCAGG - Intronic
1132175180 15:99708306-99708328 AGGTGTATTGGCTGAGAAGAGGG + Intronic
1135564271 16:23499807-23499829 AGGTTTCTACACTGTGAGGAAGG - Intronic
1137604065 16:49775644-49775666 AAGTGTATTCACTGTGAGAATGG - Intronic
1137722863 16:50638063-50638085 AGGTCTAAACACTGAGAAAACGG - Exonic
1137906098 16:52323472-52323494 AGGTGGATACTCTTTGCAGATGG - Intergenic
1143375409 17:6464177-6464199 TGGTGTCTATCCTGTGAAGATGG - Exonic
1150474205 17:65462041-65462063 AGGTGAATACATTCTGGAGATGG - Intergenic
1150890402 17:69142388-69142410 TCCTGTATCCACTGTGAAGAGGG - Intergenic
1153398721 18:4656776-4656798 GAGTGTATACTCTTTGAAGATGG - Intergenic
1154282959 18:13024175-13024197 AGGTGTATACACGTTAAGGATGG + Intronic
1154290176 18:13099552-13099574 ATCTATATACACTGTGACGATGG + Exonic
1160337547 18:78055713-78055735 AGGTGATTCCACTGTGAGGAGGG - Intergenic
1160471150 18:79134990-79135012 AGATGTATACTATGTGGAGAAGG + Intronic
1160541208 18:79624121-79624143 AGGTGTATACAGTAGGAAGCAGG + Intergenic
1161745790 19:6058938-6058960 GGGTGTTTCCACTGTTAAGACGG - Intronic
1163327829 19:16616627-16616649 AGGTGTATCCACTTTGGAGTGGG + Intronic
1166301585 19:41914482-41914504 AGATGGACACACTGGGAAGATGG - Intronic
1168171029 19:54589053-54589075 AGGTGTAAGCATTGAGAAGATGG - Intronic
1168591843 19:57642828-57642850 AGGTGTTTACTCTGTAAAGCTGG - Intergenic
925043590 2:753219-753241 AAGTGGATACAAGGTGAAGAGGG + Intergenic
925538714 2:4943200-4943222 ACGTGTGTACACAGAGAAGAGGG + Intergenic
925712339 2:6753458-6753480 AGAGGTATACAATGTGAAGTGGG + Intergenic
928918351 2:36499225-36499247 AGGTGGATCAACTGTGATGATGG - Exonic
929931237 2:46257188-46257210 AGGTGTCTACACGGTGAAAATGG + Intergenic
935070258 2:99687812-99687834 AGGTGTATTCATTGTGACAAAGG - Intronic
936681560 2:114779137-114779159 AGGGGTATACACTGATGAGAAGG - Intronic
938226981 2:129624829-129624851 AGGCGGGAACACTGTGAAGACGG - Intergenic
939645017 2:144686812-144686834 ACTTGTCAACACTGTGAAGAAGG + Intergenic
939968485 2:148634697-148634719 AGGTGTAGATACTCTGCAGAAGG - Intergenic
941852802 2:170201025-170201047 AGCAGCATCCACTGTGAAGAGGG + Intronic
943761817 2:191618302-191618324 AGGTCTATATACTGGGAAGTAGG - Intergenic
946015869 2:216603322-216603344 GGGTGAATACAGTGTGAGGAAGG + Intergenic
946224128 2:218253499-218253521 AGAGGTATACACTGTGTAGGAGG + Intronic
948172908 2:235919825-235919847 GGGTGTAAGCATTGTGAAGACGG - Intronic
948625287 2:239264776-239264798 GGGTGTAAACACTGTGCAGGGGG + Intronic
1169567534 20:6871799-6871821 AGGTGTATATACTTTGAAACTGG + Intergenic
1170195648 20:13686756-13686778 ATGTGTAAAGGCTGTGAAGAGGG - Intergenic
1170281206 20:14651039-14651061 AGGTCTATAGAATGTCAAGAGGG + Intronic
1171362113 20:24594202-24594224 TCGTGTATACAGTGTGAGGAAGG + Intronic
1171419744 20:25010040-25010062 AAGAGTTCACACTGTGAAGAGGG + Intronic
1171436420 20:25128318-25128340 GGGAGGATACAATGTGAAGATGG - Intergenic
1173150511 20:40562930-40562952 AGGTCTCTACACTGTGATGCTGG + Intergenic
1174181719 20:48679370-48679392 GGGTGTAGAGGCTGTGAAGACGG + Exonic
1177932328 21:27300292-27300314 ATGTATATTCCCTGTGAAGATGG - Intergenic
1181061362 22:20283588-20283610 AGGTCTATAAGCTGGGAAGATGG - Intergenic
950574610 3:13824572-13824594 AGGTGTATCCACTGTGGTCATGG - Intronic
955509120 3:59661811-59661833 AGGTGCTTACACTCTGAAGGGGG + Intergenic
956131515 3:66057961-66057983 AGAGGTATACAGTGAGAAGAGGG + Intergenic
956853077 3:73249202-73249224 AGCTGTATACACCAGGAAGAGGG - Intergenic
968821702 4:2857705-2857727 AGGTGTATTCAGTGTGAGGTTGG + Intronic
970444452 4:16112533-16112555 ATGTGCATACTCTGGGAAGAGGG - Intergenic
971003017 4:22343432-22343454 AGGAGAATACTGTGTGAAGATGG + Intergenic
973290923 4:48469661-48469683 AAGTAGATGCACTGTGAAGAGGG + Intergenic
975395978 4:73873673-73873695 AGGTGTAAACATAATGAAGAGGG - Intergenic
975981608 4:80167003-80167025 AGGTGCATACAGATTGAAGATGG + Intergenic
976809011 4:89080355-89080377 ATGTGTCTTCACTGGGAAGATGG + Intronic
979714704 4:123823485-123823507 AGGAGGAGACACTGTGCAGATGG - Intergenic
981487492 4:145302423-145302445 AGCTACATACACTGTGGAGATGG - Intergenic
981638015 4:146902554-146902576 AGGAATATATTCTGTGAAGAGGG - Intronic
981700071 4:147598586-147598608 AGGTGGATGCACTTTGAACATGG - Intergenic
983210350 4:164952086-164952108 GGGTTTATACACTGTAAGGATGG + Intergenic
983481329 4:168277957-168277979 TGGTGTCTACAGTGTGAACATGG - Intronic
987420406 5:17713736-17713758 TGGTGGATACACGGTGGAGATGG - Intergenic
988485460 5:31665016-31665038 AGGAGTCTACACTATGAAGGGGG + Intronic
988661390 5:33273471-33273493 AGATGTATACAATGTGTGGAAGG + Intergenic
990101110 5:52188426-52188448 AGATGTCTACACTGTGAAAATGG + Intergenic
990390537 5:55315123-55315145 AGTTCAATACACTGTGAAAAAGG - Intronic
991024084 5:62011167-62011189 AGGAGTATACACAGGGAAGCAGG + Intergenic
992822111 5:80507795-80507817 ATGTGAAAACACTGTGAAGGTGG - Intronic
993023136 5:82616020-82616042 AGGTGTATACTCAGTAATGATGG - Intergenic
994587823 5:101733454-101733476 AGGTGTATACACTGTGTTGAAGG + Intergenic
996567014 5:124891218-124891240 CTTTGTAAACACTGTGAAGATGG + Intergenic
999798864 5:155014156-155014178 AGGTGCATACACTGCGGAGCAGG + Exonic
999881865 5:155873620-155873642 ACGTGGATACACTGTGAAGTTGG - Intronic
1000511178 5:162185141-162185163 TGGTGTAGACACAGTGAATAGGG - Intergenic
1001960956 5:175880210-175880232 AGGTGGATACCCTGGGATGAAGG - Exonic
1002309438 5:178305881-178305903 AGGTGTCTACACAGGGAAGCAGG + Intronic
1004139943 6:13009078-13009100 AGGAGAAGACAATGTGAAGATGG - Intronic
1007289157 6:40771959-40771981 AGGTTTATACACTGTGTAGGAGG + Intergenic
1008002046 6:46370823-46370845 AGGAGTATACACTATGCAGTGGG - Intronic
1009632349 6:66214889-66214911 GGGTGGAGACACTGGGAAGATGG + Intergenic
1013617679 6:111859969-111859991 AGGAAAATACCCTGTGAAGATGG + Intronic
1014083810 6:117318240-117318262 TGTTGTATAGACTTTGAAGAAGG - Exonic
1019486214 7:1290587-1290609 AGCTGTGCACACTGTGAAGTAGG - Intergenic
1022535395 7:31095481-31095503 AGGTGTCTGCACTGGGAGGAGGG + Intronic
1024506654 7:50167752-50167774 GGGTGTTGTCACTGTGAAGAGGG - Intergenic
1024677929 7:51654647-51654669 AGGGGTATCCCCTCTGAAGATGG + Intergenic
1024977181 7:55124759-55124781 AGGTTTATAGACTGTGAATTTGG - Intronic
1026831903 7:73615518-73615540 GGGTGTTTCCACTGTGAAGCTGG - Intronic
1027879896 7:83821469-83821491 AGGTGTTTCCTCTTTGAAGAGGG - Intergenic
1028205529 7:88012596-88012618 AGGTGTAGACTCTAAGAAGAAGG - Intronic
1029156703 7:98522373-98522395 AAATGTATACCCTGGGAAGAAGG - Intergenic
1030309355 7:108053907-108053929 AGCTGTATACATTTTGAAGTGGG + Intronic
1032673542 7:134107498-134107520 TGGTGTATGCACTGTGTAAATGG + Intergenic
1033797724 7:144867810-144867832 AGATATTTACACTATGAAGAAGG - Intergenic
1035287360 7:157814846-157814868 AGGTGTCCACACTTTGCAGAGGG + Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1043321142 8:78988256-78988278 AGGTGTATACATTGTAGAAAAGG - Intergenic
1047659051 8:127012623-127012645 AGTTGTATACACTGTAAACTAGG + Intergenic
1048347231 8:133585388-133585410 AGGTGAATAGGCTGTGAAGATGG - Intergenic
1048403512 8:134095307-134095329 TGATGAATCCACTGTGAAGATGG + Intergenic
1051329658 9:16010860-16010882 AAGAGTATACAATGAGAAGAGGG + Intronic
1051766357 9:20528643-20528665 AGGCGAAGGCACTGTGAAGATGG - Intronic
1052564016 9:30123303-30123325 AATTGTATAAACTCTGAAGATGG + Intergenic
1055794458 9:79960019-79960041 AAGTGTAAACACTGTGAACAAGG + Intergenic
1056185879 9:84134507-84134529 AGGTGTGTTAACTGTAAAGAAGG + Intergenic
1056867238 9:90239273-90239295 AGGTTTATAATCTGTAAAGAAGG - Intergenic
1057269268 9:93639171-93639193 AGGTTTTAACACTGTTAAGATGG - Intronic
1060160739 9:121360928-121360950 CAGTGTATACACTGGGAAAATGG + Intronic
1185729058 X:2446441-2446463 AGCTGTGTACACACTGAAGACGG + Intronic
1185914824 X:4024274-4024296 AGGTATATCCTCTGTGATGAGGG + Intergenic
1187440640 X:19315428-19315450 AGGTATATACACTCAGAAGTGGG + Intergenic
1187529579 X:20084299-20084321 AGGTGTATACACTGTGAAGAAGG - Intronic
1189714909 X:43855329-43855351 AAGTCTATACACTGTTAGGATGG - Intronic
1189843151 X:45103960-45103982 AGGTGTAAACACATAGAAGATGG - Intronic
1191014626 X:55795168-55795190 AGGTGGAAAAACTGAGAAGAGGG - Intergenic
1194159732 X:90435930-90435952 CTGTGTATATACTGTGAAGAGGG + Intergenic
1194967993 X:100311287-100311309 AGGAGAATACATAGTGAAGATGG + Intronic
1196611794 X:117723627-117723649 AGGTGTTTAGACTCTGTAGAAGG + Intergenic
1196916105 X:120536541-120536563 AGGGGTATAACCTGGGAAGATGG + Intronic
1197492361 X:127133782-127133804 AGGTACATACACTGGGAATAAGG + Intergenic
1200506034 Y:4012896-4012918 CTGTGTATATACTGTGAAGAGGG + Intergenic