ID: 1187533618

View in Genome Browser
Species Human (GRCh38)
Location X:20117718-20117740
Sequence TGTCGTTGAAAGGCCTAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187533618_1187533626 16 Left 1187533618 X:20117718-20117740 CCGACCTAGGCCTTTCAACGACA No data
Right 1187533626 X:20117757-20117779 ATTTGGTTCCTCTTCTCCTGAGG No data
1187533618_1187533621 -1 Left 1187533618 X:20117718-20117740 CCGACCTAGGCCTTTCAACGACA No data
Right 1187533621 X:20117740-20117762 ACCCTACTCCGCAGCCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187533618 Original CRISPR TGTCGTTGAAAGGCCTAGGT CGG (reversed) Intergenic
No off target data available for this crispr