ID: 1187534425

View in Genome Browser
Species Human (GRCh38)
Location X:20125891-20125913
Sequence GGTAAGAAGCGGTCTCTTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187534421_1187534425 1 Left 1187534421 X:20125867-20125889 CCATCATGCATAGTTTACAGGCT 0: 2
1: 0
2: 1
3: 6
4: 89
Right 1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG 0: 1
1: 1
2: 0
3: 12
4: 94
1187534419_1187534425 23 Left 1187534419 X:20125845-20125867 CCTAAATAAAATACAAGAATTTC 0: 2
1: 2
2: 3
3: 68
4: 850
Right 1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG 0: 1
1: 1
2: 0
3: 12
4: 94
1187534418_1187534425 28 Left 1187534418 X:20125840-20125862 CCATTCCTAAATAAAATACAAGA 0: 2
1: 0
2: 2
3: 85
4: 2133
Right 1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG 0: 1
1: 1
2: 0
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187534425 Original CRISPR GGTAAGAAGCGGTCTCTTTA GGG Exonic
902475572 1:16683200-16683222 GGTAAGAAGCAGTCTCTTTAGGG + Intergenic
906729184 1:48066619-48066641 GGCAAGAGGCTGTCTCTTTCAGG - Intergenic
908528822 1:65013491-65013513 GGTCAGCAGCAGTCCCTTTAGGG - Intergenic
908979513 1:69937851-69937873 GGTAAGAAAGCCTCTCTTTAAGG - Intronic
913041004 1:115023024-115023046 GGTAAGAAGGAGTTTCTTGAGGG + Intergenic
918307471 1:183260195-183260217 GGCAAGAAGCTTTGTCTTTAAGG - Intronic
922685265 1:227633951-227633973 GGAAGGAAGGGGTCTCTTTTTGG - Intronic
924790573 1:247243805-247243827 GGTAAGAAGCAGTCTCAAAAGGG + Intergenic
1072423766 10:95311616-95311638 GGTAAGAAGTGGTGTCTTCAAGG + Intergenic
1076734865 10:132454242-132454264 GGAAAGAAGCCGTCTCCGTAAGG + Intergenic
1079030741 11:16984579-16984601 GGTCAGAAGAGGCCTCTTTGTGG - Intronic
1079675500 11:23221300-23221322 TGTAAGATGCGGTCTATTTGGGG + Intergenic
1083314885 11:61808547-61808569 GGTCAGAAGGGTTCTATTTAGGG - Intronic
1090853417 11:130590561-130590583 GGTAAGATGCTGTCTCATTATGG + Intergenic
1090996539 11:131870945-131870967 GGTAAGATTGGGTCTATTTAAGG + Intronic
1091027325 11:132153398-132153420 GGTTGGATGAGGTCTCTTTATGG + Intronic
1092036740 12:5342595-5342617 GGTAAGAAGTGGTGTCTCTTTGG + Intergenic
1097014379 12:55974607-55974629 GGTAAGAAGCGTTCTTTTCAGGG + Intronic
1099081475 12:78188322-78188344 TGTAATAAGACGTCTCTTTAAGG + Exonic
1105983290 13:25540802-25540824 GGTAAGAATAGTTTTCTTTAAGG - Intronic
1110795978 13:79638860-79638882 GGTAAGCAGCTGTCTCCTTAGGG - Intergenic
1111511508 13:89270741-89270763 GGTAAAAATAGGTGTCTTTATGG + Intergenic
1114347515 14:21811894-21811916 GGAAAGAAGTGGTTTCTTTACGG - Intergenic
1114358440 14:21941574-21941596 GGAAAGAAGTGGTTTCTTTACGG - Intergenic
1120394238 14:83947509-83947531 GGTAAGATGCTATCTCTTTGTGG + Intergenic
1202829064 14_GL000009v2_random:6060-6082 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1124637467 15:31374191-31374213 GGTAAGAAGCGGGCACCTGACGG - Exonic
1125902740 15:43364068-43364090 GGCAAGAAGCAGTCTCTTCCTGG + Exonic
1128555352 15:68628000-68628022 GGTTGGAGGAGGTCTCTTTATGG - Intronic
1131114750 15:89787924-89787946 GGTAGGAAGTGGTATCATTATGG - Intronic
1132520247 16:383953-383975 GGAAACAAAGGGTCTCTTTAAGG - Intronic
1135054540 16:19220011-19220033 TGGAAGATGCGGTGTCTTTAGGG - Intronic
1135590650 16:23702602-23702624 GGTAAGAAGTGGTCTCTGAGTGG - Exonic
1140958975 16:79894501-79894523 GCCAAGAAGCTGTCTCCTTAGGG - Intergenic
1146367076 17:32237507-32237529 GGTACGAAGGGTTCTGTTTAAGG - Intronic
1153787123 18:8544989-8545011 GGAAAGAAGGGGTAGCTTTAGGG + Intergenic
1154065882 18:11106595-11106617 GTAAAGAAGAGGTCTCATTATGG + Intronic
1202643634 1_KI270706v1_random:121729-121751 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
926473790 2:13296096-13296118 GGTGACAACTGGTCTCTTTATGG - Intergenic
928586237 2:32761294-32761316 GGTAAGAAGCAGTCTGATTCTGG - Intronic
935222936 2:101030451-101030473 GGTAAGAAGTGGTATAATTATGG - Intronic
935520384 2:104096861-104096883 GGTCTGAAGCTGTCCCTTTACGG - Intergenic
936175410 2:110215655-110215677 GGTAAGAAGCGATTTCATTCTGG - Intergenic
937552233 2:123108228-123108250 AGAAAGAAGGGGTCTCTTTTTGG + Intergenic
938392811 2:130918296-130918318 GGACAGAAGCGGTCACTTTGTGG - Intronic
938777089 2:134551457-134551479 GTTGAGAAGAGCTCTCTTTATGG + Intronic
939113255 2:138032452-138032474 GATCAGAAGAGGTCTCTTTCAGG + Intergenic
941860906 2:170279335-170279357 GGTAAGAAGTGATCTCATTGTGG + Intronic
1171893600 20:30740679-30740701 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
1172195485 20:33089029-33089051 GGTAAGAAGCTGTCCCAGTATGG + Exonic
1173073147 20:39789458-39789480 GGCAAGATGCGGTTTTTTTAAGG - Intergenic
1173134573 20:40427956-40427978 GCTAAGAATCTGACTCTTTAGGG + Intergenic
1176608248 21:8850899-8850921 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1176876568 21:14135887-14135909 GGGAAGAAGGGGTCTTTTTTTGG - Intronic
1178909966 21:36666497-36666519 GGAGAGAAGCGTTCTGTTTAGGG + Intergenic
1180358331 22:11860704-11860726 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1180379931 22:12131626-12131648 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
961078593 3:124004764-124004786 GGTAAGTTGGGTTCTCTTTATGG - Intergenic
963760890 3:149286063-149286085 GGTAAGAAGTGGGGTCTTTTTGG + Intergenic
971089993 4:23331127-23331149 GGTAAGGATGGGCCTCTTTAAGG + Intergenic
971388117 4:26160215-26160237 GCCAAGAAGCTTTCTCTTTAAGG + Intergenic
972817081 4:42656730-42656752 GGTAGGATGCGGTCTCTTCCAGG + Intronic
974101245 4:57419815-57419837 GCTAACAAGTGCTCTCTTTAGGG + Intergenic
983456228 4:167968455-167968477 GGAAGGAAGGGGTCTCTTTTGGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984793433 4:183635366-183635388 GGTGAGAAGCGGTCAGTTTCTGG - Intergenic
1202771001 4_GL000008v2_random:207642-207664 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
988906703 5:35798055-35798077 GGGAAGAAGTGGTCTCATTCGGG - Intronic
989999340 5:50874922-50874944 GTTTAGAAGCGTTCTATTTAAGG - Intergenic
990586408 5:57215734-57215756 GGTAAGAAGCAGTCTCTCAAAGG - Intronic
990586424 5:57215951-57215973 GGTAAGAAGCAGTCTCTCAAAGG - Intronic
994775016 5:104029548-104029570 GGCAAGAAGCTGTCTGTTAAGGG - Intergenic
998689902 5:144575940-144575962 GGTAAGAAGCAGGCTGTTTCAGG + Intergenic
1000091686 5:157935037-157935059 GGCAAGAAGCGGTTTGTTTTGGG + Intergenic
1001097377 5:168786246-168786268 AGGAAGAAGCGGTCTCTTTGTGG + Intronic
1001451321 5:171826890-171826912 GGTAAGAAGGGGACTCATGAAGG + Intergenic
1001980047 5:176031615-176031637 AGTAAGAAGCGTTCTCCTTTGGG + Intronic
1002237335 5:177812048-177812070 AGTAAGAAGCGTTCTCCTTTGGG - Intergenic
1003374378 6:5562293-5562315 GTTAAGAAGTGGTCTTTTAACGG + Intronic
1003705971 6:8530171-8530193 GGTAAGAAGCAGCCTTTTTTGGG + Intergenic
1010587336 6:77669478-77669500 GCTAAGAAGCTGACTTTTTAAGG + Intergenic
1011600859 6:89058871-89058893 GGTAAGAAGCAGTCTCCATATGG - Intergenic
1012631582 6:101476389-101476411 GATAAGAAGCCAGCTCTTTAAGG + Intronic
1020862040 7:13505769-13505791 GGTGAGATCCTGTCTCTTTAGGG - Intergenic
1022777982 7:33547143-33547165 GGCAAGAAGAGGACTCTGTAGGG + Intronic
1030501291 7:110363489-110363511 GGTAAGAAGCAGTGTAATTATGG + Intergenic
1031454826 7:121966032-121966054 GATAAGAAGAGGTCTGATTAGGG + Intronic
1032837856 7:135690502-135690524 GGTAATAGGCGATCTCTGTAAGG - Intronic
1042145089 8:65719869-65719891 GCTAAGAAGGGGTCTCCTTCAGG + Intronic
1043048254 8:75354209-75354231 AGAAAGAAGCAGTCTCTTTCAGG + Intergenic
1050080813 9:1913911-1913933 AGCAAGAGTCGGTCTCTTTAGGG + Intergenic
1054355038 9:64052041-64052063 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1055521686 9:77087757-77087779 GGTAAGCATCAGTCTCTCTAAGG + Intergenic
1055676612 9:78669050-78669072 GGTAAAAACTGGTCTCTTTCTGG + Intergenic
1057386637 9:94610814-94610836 GGTTAGGAGCTGTCTCCTTAAGG - Intronic
1060326759 9:122623741-122623763 GGTAAGATTGGTTCTCTTTATGG + Intergenic
1060433046 9:123567048-123567070 GGTTAGAAGCAATCTTTTTATGG - Intronic
1060657216 9:125380420-125380442 GGGAAGAAGAGGCCTCTTCAAGG + Intergenic
1061082644 9:128381378-128381400 GGTCAGCAGAGGTCTCTTTAAGG + Intronic
1203743371 Un_GL000218v1:21146-21168 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG + Exonic
1191693918 X:63968588-63968610 GGTAAGAAGTGGGCACATTATGG + Intergenic
1194062901 X:89226330-89226352 GGAAAGAAGCCGTCTCCGTAAGG - Intergenic
1194338857 X:92683994-92684016 GGTAAAAAGCCTTCTATTTATGG - Intergenic
1195811049 X:108830337-108830359 GGTAAGATGCTATCTCATTATGG - Intergenic
1200647250 Y:5800774-5800796 GGTAAAAAGCCTTCTATTTATGG - Intergenic
1200716714 Y:6554998-6555020 GGAAAGAAGCCGTCTCTGTAAGG - Intergenic
1201156896 Y:11138617-11138639 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic