ID: 1187534485

View in Genome Browser
Species Human (GRCh38)
Location X:20126912-20126934
Sequence TTCCTTTTGAAGCCATGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187534485 Original CRISPR TTCCTTTTGAAGCCATGTGA AGG Exonic
902475630 1:16684221-16684243 TTCCTTTTGAAGCCATGTGAAGG + Intergenic
902888607 1:19425094-19425116 TTTATTTTGTAGCCATGTGAGGG - Intronic
902889704 1:19433522-19433544 TGTCTTTGGAAGCCATGTGCAGG - Intronic
905581696 1:39087255-39087277 TTGCTTATGAAGCCAAGTGGGGG + Intronic
905784935 1:40747631-40747653 TTCTTATTGAAGCTAAGTGATGG + Intronic
906003473 1:42447433-42447455 TTCATTTTGTTGCCATGTGTTGG - Intronic
907359989 1:53906563-53906585 TTCCTTTTGAACCCAGATGATGG + Intronic
908577632 1:65477673-65477695 TTCCTGTTGAACCCATTTGAGGG - Intronic
910979990 1:92950470-92950492 TTACTTTGGAAGCAATGTGGAGG + Intronic
913367659 1:118059263-118059285 TTCCCTGTGAAGTAATGTGAAGG + Intronic
913945299 1:125156605-125156627 TTCCATTTGAAACCATTTGATGG + Intergenic
914889173 1:151607588-151607610 TTCCTTTTTATGCCATGTCTTGG + Intergenic
916823646 1:168424271-168424293 TTCCTTTTGAAGCCAAGTCAGGG - Intergenic
917325658 1:173829372-173829394 TTGAATTTGAAGCCATGTGACGG + Intronic
919462435 1:197893939-197893961 CCCCTTTTGCACCCATGTGAGGG - Intergenic
919616075 1:199810752-199810774 CTCCTTATAAAGCCATTTGATGG - Intergenic
920147849 1:203878013-203878035 TGCCATTTGAAACAATGTGAAGG - Intergenic
921544894 1:216463214-216463236 TTCCTTTTAAAGACAAATGATGG - Intergenic
921573922 1:216811823-216811845 TTCCATTTTAAGCCTAGTGATGG + Intronic
923486246 1:234434256-234434278 TTCCTTCAGAAACCCTGTGATGG - Intronic
924465728 1:244297776-244297798 TTGCTTGTGAAGCCATTTGAGGG + Intergenic
1065306359 10:24373005-24373027 TTCCTTATGACTCCAAGTGAGGG - Intronic
1065689937 10:28322732-28322754 TTCCTTTAGCAGCTGTGTGAGGG + Intronic
1068839576 10:61595316-61595338 TTCATTTTGAAGAAATGAGATGG - Intergenic
1070986301 10:80692963-80692985 TTCCTTTGGAAGCTAGGGGATGG - Intergenic
1071156927 10:82700671-82700693 TTTCTTTAGAAGCCATATGCAGG + Intronic
1071729732 10:88235301-88235323 TTCATTTTGGATCCATGTTAGGG - Intergenic
1073298083 10:102453200-102453222 GTCCTTTTGAAGGCAGGTGCTGG + Intergenic
1074854807 10:117465697-117465719 TTCCATCTCAAGCCCTGTGATGG + Intergenic
1078496497 11:11822850-11822872 TTCCTTTTGAAGCTGTATGTTGG + Intergenic
1078749693 11:14149116-14149138 TTCCTTTGGAATACCTGTGAAGG - Intronic
1079406051 11:20146643-20146665 TTCCATTTGCAGCCATCAGAGGG - Intergenic
1080356825 11:31458257-31458279 TTCCTTTTAAAACTATTTGAAGG - Intronic
1080509656 11:32956265-32956287 ATTCTTTTGAAGGCATGAGATGG + Intronic
1081220808 11:40458809-40458831 TACTCTTTGAAGCCAAGTGAAGG - Intronic
1083054051 11:59802793-59802815 CACCTTTTTAAGCCATGTGCTGG + Intergenic
1083331911 11:61902660-61902682 TTCCTTTGGAAGCCGGGTGGGGG - Intronic
1085535166 11:77213152-77213174 CAGCTTTTGAAGCCACGTGATGG - Intronic
1086615417 11:88812034-88812056 TTCCTTTTGTAACCACTTGAAGG - Intronic
1087412409 11:97808583-97808605 TGCCTTTTGGAGCTATGAGAAGG + Intergenic
1088174683 11:107038719-107038741 TTCCTTTTAAAGTTAAGTGATGG - Intergenic
1088354277 11:108925892-108925914 TTTCCTTTGAAGTCATTTGAAGG + Intronic
1092278176 12:7078364-7078386 TTCCATTTGTAGCCAGGTGGTGG - Intergenic
1092957053 12:13560759-13560781 TTCATTTTAAAGCCAACTGAAGG - Exonic
1095419110 12:42006693-42006715 TCCCTAGTGAAGCCATATGATGG - Intergenic
1095636027 12:44434733-44434755 TTGCTTTTGAATCCCTGTTAAGG + Intergenic
1097675820 12:62602328-62602350 TTTCTTTTTAAGCCAAGTTAGGG - Exonic
1098033678 12:66280616-66280638 TTCCTTTGGAAGCCACCTCAGGG + Intergenic
1098036614 12:66309408-66309430 TGCCTTTAGAAGGCATGAGAAGG + Intronic
1100727764 12:97427089-97427111 TTGCTGTTGAAGCCATGTGCTGG + Intergenic
1102770195 12:115469480-115469502 TTCCCTAGGAAGCCATGCGATGG - Intergenic
1105616988 13:22028026-22028048 TTCCTCTGGAAACCAAGTGAAGG - Intergenic
1108131317 13:47303764-47303786 TTCTTGTGCAAGCCATGTGATGG + Intergenic
1109537815 13:63740423-63740445 ATCCTTTTGAAACCCTGTGTAGG + Intergenic
1109970042 13:69756076-69756098 TTCCTTTTGAAGTGAAGGGATGG - Intronic
1110384260 13:74890469-74890491 TTCCTTTTGAGGCTGTGAGAAGG - Intergenic
1110611617 13:77494347-77494369 TTATTTTTGAAGCCAGGTGGTGG - Intergenic
1111032223 13:82617567-82617589 TTCCTTTTGCAAGCATGTCATGG - Intergenic
1111425869 13:88081199-88081221 TTCATTTTGAAGTCATGTTCTGG + Intergenic
1111697734 13:91646253-91646275 TTCATTTTAAAGCCATTTTAAGG + Intronic
1111882954 13:93981402-93981424 TGCCCTTTGGGGCCATGTGAGGG + Intronic
1113144279 13:107189958-107189980 TTGCTCAAGAAGCCATGTGAGGG + Intronic
1113308595 13:109106621-109106643 TTCATTTTAAAGCCATCTGGAGG + Intronic
1113459477 13:110471970-110471992 TTCATTCTGAGGCCATGTCAGGG + Intronic
1116265970 14:42690688-42690710 TTGCAGTTGAGGCCATGTGATGG + Intergenic
1116707269 14:48317986-48318008 TTTCTTTAGTAGCCAAGTGAAGG - Intergenic
1117713573 14:58557829-58557851 TGCCTTTTCATCCCATGTGAGGG + Intergenic
1117799820 14:59431657-59431679 TTCCCTCTGAAGCCATCAGAAGG + Intronic
1118395928 14:65336543-65336565 TTTGTTTTGAAGCCATTGGAGGG + Intergenic
1119006381 14:70934012-70934034 TTCCTTGTGCAGCAATGTAAAGG - Intronic
1119191579 14:72686235-72686257 TTCCATCTGAGCCCATGTGATGG - Intronic
1119729970 14:76945060-76945082 TTCTTTCACAAGCCATGTGAGGG - Intergenic
1121826292 14:97012350-97012372 TTCCATTTAAAGGAATGTGAGGG + Intergenic
1122069984 14:99200055-99200077 TGCCTTTTGAAGCCGAGGGATGG - Intronic
1123824417 15:24067238-24067260 TTCATTTTTAAGCCAGCTGAAGG + Intergenic
1124578130 15:30927409-30927431 GTCCTTTTGAATCCCTGAGACGG + Intronic
1125581988 15:40792478-40792500 TTTCATTTGAAGCCCTTTGAAGG - Intronic
1125855507 15:42945583-42945605 TCCCTTTTTAAGCCCTGTGCTGG - Intronic
1126218399 15:46183824-46183846 TCCCTTTTGGAACTATGTGAAGG + Intergenic
1127664271 15:61129712-61129734 TTCCTTGTGAAGCCCTGGTAGGG - Intronic
1128762494 15:70226968-70226990 TTCCTTTGGGAGCAATGTGAGGG + Intergenic
1129166927 15:73783864-73783886 TTTCTCCTGATGCCATGTGAAGG + Intergenic
1130334737 15:82949252-82949274 TGGCATTTGAAGCCATGGGAGGG + Intronic
1130781641 15:87045969-87045991 TTTCTTTTGAAGATATGTGAAGG + Intergenic
1131247467 15:90807797-90807819 GTCTTTTTGAAGACATGTCATGG + Intronic
1133458522 16:5965612-5965634 TTTCTTTTGAAGCTTTGTGGAGG - Intergenic
1135327617 16:21537109-21537131 TTCCTTTTGAAGTCATTTCTTGG + Intergenic
1136100827 16:27994387-27994409 TTCTTTTGGAAGTCATCTGAAGG - Intronic
1136140083 16:28282732-28282754 TTATTCTTGGAGCCATGTGAGGG - Intergenic
1136337970 16:29623129-29623151 TTCCTTTTGAAGTCATTTCTTGG + Intergenic
1136934823 16:34451061-34451083 TTCCTTTTGATTCCATTCGATGG - Intergenic
1136937162 16:34481901-34481923 TTCCTTTTGATTCCATTTGATGG - Intergenic
1136941847 16:34593102-34593124 TTCCATTTGATTCCATGCGACGG + Intergenic
1136944253 16:34627989-34628011 TTCCTTTTGATTCCATTTGATGG + Intergenic
1136947234 16:34667552-34667574 TTCCTTTTGATTCCATTCGATGG + Intergenic
1136952390 16:34737625-34737647 TTCCATTTGATGCCATTAGATGG + Intergenic
1136962657 16:34866669-34866691 TTCCTTTTGATTCCATTTGATGG + Intergenic
1136969749 16:34960753-34960775 TTCCTTTTGATTCCATTCGATGG + Intergenic
1137089797 16:36174996-36175018 TTGCTTTTGATTCCATTTGATGG + Intergenic
1137217456 16:46410583-46410605 TTCCTTTGGACTCCATTTGATGG - Intergenic
1137581349 16:49635465-49635487 TTGCCTTTCCAGCCATGTGATGG - Intronic
1141109402 16:81259617-81259639 TTGATTTTAAAGCCCTGTGAAGG + Intronic
1141714101 16:85717001-85717023 ATCCTTCTGAAGCCTTGGGACGG - Intronic
1142040729 16:87892210-87892232 TTCCTTTTGAAGTCATTTCTTGG + Intronic
1144423030 17:15115215-15115237 TTCCTTCTGAGGCCATGAGGGGG + Intergenic
1144764565 17:17725456-17725478 TTCCCATTGAGGCCATGGGAAGG + Intronic
1146248090 17:31309027-31309049 TTCCTTATAAAGTCATTTGAAGG - Intronic
1148476147 17:47929962-47929984 TTACTTTTTCAGCCATTTGAGGG - Intergenic
1151210090 17:72538054-72538076 CTCCTGTTGAAGTCATGGGATGG - Intergenic
1203184277 17_KI270729v1_random:97913-97935 TTCCATTTGATTCCATTTGATGG + Intergenic
1203184407 17_KI270729v1_random:99644-99666 TTCCATTCGAATCCATTTGATGG + Intergenic
1203185913 17_KI270729v1_random:119434-119456 TTCCATTTGATTCCATTTGATGG + Intergenic
1203186290 17_KI270729v1_random:124312-124334 TTCCATTTGATTCCATTTGATGG + Intergenic
1153720856 18:7901210-7901232 TTGCTTTTGAAGCCTTATAAGGG + Intronic
1157004350 18:43564010-43564032 TTCCTATTTGGGCCATGTGATGG - Intergenic
1157572404 18:48721666-48721688 TGCCATTAGATGCCATGTGATGG + Intronic
1157585448 18:48798113-48798135 TTCCTTCTGCAGACCTGTGAGGG + Intronic
1165077055 19:33285603-33285625 TTCCCTTTGAAGACACGTGCTGG - Intergenic
1166002194 19:39884325-39884347 TTATTTTTGAAGCTAAGTGATGG + Intronic
1166004978 19:39900576-39900598 TTATTTTTGAAGCTAAGTGATGG + Intronic
925261046 2:2528938-2528960 TTCCTTTGCAATCCATGGGAAGG - Intergenic
925496810 2:4460207-4460229 TTCCTTTTAAAGTAATATGATGG + Intergenic
926765516 2:16319941-16319963 CTCCTTTTGATGACATGTGAGGG - Intergenic
928133587 2:28671440-28671462 TACCTTTAGAAGCCTTGAGATGG + Intergenic
928557194 2:32439530-32439552 TTCGTTTTTAATCCATGTCAAGG + Exonic
929036675 2:37699758-37699780 TTCCTTTGGCAGCCAGGTGGAGG + Intronic
929981530 2:46685288-46685310 TTCCTGTTGAAGAGATGAGAAGG - Intergenic
934191333 2:89798634-89798656 TTCCTTTCGATTCCATTTGATGG + Intergenic
934192275 2:89810486-89810508 TGCCTTTTGATGCCATTTGGTGG - Intergenic
934332581 2:92084359-92084381 TTCCATTTGATTCCATTTGATGG + Intergenic
935316014 2:101834514-101834536 TTCTTTTTGAAGTCTTGGGAGGG - Intronic
936176127 2:110221528-110221550 ATCCTTTGGCAGCCATGAGAAGG - Intergenic
936921969 2:117697990-117698012 GTTCTTCTGAAGCCATGAGAAGG - Intergenic
938040304 2:128070241-128070263 TTGCTTTTGAAGGCGTGTGGGGG - Intergenic
938219879 2:129556904-129556926 TTCCTTGTGAATGCCTGTGAGGG - Intergenic
939680160 2:145120804-145120826 TTCCCTTTGGAGCCATTTGCTGG - Intergenic
940606297 2:155927272-155927294 CTACTTTTGAAGCCAGGAGATGG + Intergenic
941332361 2:164194552-164194574 TTCCTTTTAAAGATATATGATGG + Intergenic
941362839 2:164573970-164573992 TTCCTTTAGAAGCCAGATGTTGG + Intronic
941751449 2:169139185-169139207 ATTCATATGAAGCCATGTGAAGG - Intronic
941967928 2:171318417-171318439 ATCCTTTTGAAGACATTTTAAGG + Exonic
944002136 2:194852306-194852328 TTCTCTTTGAAGCAATTTGATGG + Intergenic
947070640 2:226284220-226284242 TTCCTTCTGAAGACATTTCAGGG + Intergenic
947087807 2:226475265-226475287 AGACTTTTGAAACCATGTGATGG + Intergenic
948398941 2:237668488-237668510 TACATTTTAAAGCCATATGATGG + Intronic
948648733 2:239425683-239425705 TTCCTTTGGATGCCATGTTTTGG - Intergenic
1170440748 20:16376642-16376664 TTCCTTCAGAAGCCAAGTAAAGG - Intronic
1170773499 20:19355156-19355178 TCCCTTCTGATGCCATGTGGAGG - Intronic
1172322388 20:34006198-34006220 TAACTGTTGAAGCCAAGTGATGG - Intronic
1174563324 20:51446605-51446627 TTCCGTTTGCATCCATTTGAAGG - Intronic
1174810702 20:53643016-53643038 TTCCTTTTGAAGACAGGAGCAGG - Intergenic
1175009501 20:55720868-55720890 TTCCTTTTGAAGTCAGTTGGGGG - Intergenic
1175045596 20:56101982-56102004 ATCTCTTTGTAGCCATGTGAAGG + Intergenic
1175667694 20:60874176-60874198 GTCCTTGTGAAGCCATCTCAGGG + Intergenic
1178174864 21:30085399-30085421 TTCATTTTGTTGCCATGGGATGG - Intergenic
1180528703 22:16325571-16325593 TTCTGTTTGAAGCCATTTGATGG + Intergenic
1180532993 22:16365913-16365935 TTCTTTTCGAATCCATTTGATGG - Intergenic
1180762790 22:18222316-18222338 TTCCTTTTGCAGCCAGGAGTGGG - Intergenic
1180772877 22:18402292-18402314 TTCCTTTTGCAGCCAGGAGTGGG + Intergenic
1180804235 22:18651847-18651869 TTCCTTTTGCAGCCAGGAGTGGG + Intergenic
1180806518 22:18717569-18717591 TTCCTTTTGCAGCCAGGAGTGGG - Intergenic
1181217464 22:21343350-21343372 TTCCTTTTGCAGCCAGGAGTGGG - Intergenic
1203234712 22_KI270731v1_random:143280-143302 TTCCTTTTGCAGCCAGGAGTGGG + Intergenic
1203316650 22_KI270737v1_random:19883-19905 TTCTTTTCGAATCCATTTGATGG + Intergenic
1203321049 22_KI270737v1_random:61487-61509 TTCTGTTTGAAGCCATTTGATGG - Intergenic
1203321568 22_KI270737v1_random:68305-68327 TTCCATTTGATGCCATTCGATGG - Intergenic
1203327397 22_KI270738v1_random:38940-38962 TTCCTTTTGATTCCATTCGATGG - Intergenic
1202727000 2_KI270716v1_random:10967-10989 TTCCATTTGATTCCATTTGATGG + Intergenic
950141537 3:10619374-10619396 TTCGGTTTGAAGCCTTGAGAAGG - Intronic
952112109 3:30136109-30136131 TACCTTTTGAAGTCCTGTCAAGG - Intergenic
952722152 3:36544743-36544765 TCCCTTTTGAAGTCATGTCAAGG + Intronic
953607963 3:44424230-44424252 TGTTTTTTGGAGCCATGTGATGG - Intergenic
954673441 3:52302908-52302930 TGCATGTTGAAGCCATGTGATGG - Intergenic
955745093 3:62132688-62132710 TTCCTTTTGCTGGGATGTGAAGG + Intronic
957017475 3:75084944-75084966 ATTCTTTTTAAGCCATGTCAAGG + Intergenic
958528270 3:95290912-95290934 TTCTTTCTGCTGCCATGTGAAGG + Intergenic
960699889 3:120429206-120429228 TTCCTTTGGATGCCCTCTGAAGG - Intronic
961639325 3:128355077-128355099 TTCCCCTTGATGCCATGTGTGGG + Intronic
962883441 3:139600791-139600813 TTCCTCTGGAAGCTATGTAAGGG - Intronic
962953858 3:140246420-140246442 TTCCTGTTTGAGCCAGGTGAAGG + Intronic
963544434 3:146637977-146637999 TTCCCTTTGAAGTCTTTTGAGGG - Intergenic
964040825 3:152259682-152259704 TGCCTTTAGAGGCTATGTGATGG + Intronic
965815406 3:172631309-172631331 TTCTTTTTGACACCATTTGAAGG - Exonic
966129544 3:176621851-176621873 TGCTAATTGAAGCCATGTGAAGG + Intergenic
966368967 3:179225879-179225901 TTCATTTGAAAACCATGTGATGG + Intronic
970193701 4:13537055-13537077 TTCATTTAGAAGCCAAGTCATGG - Intergenic
970324451 4:14908967-14908989 TTCCTCTTCCAGCCATGTGGTGG - Intergenic
970506430 4:16735048-16735070 TTTCTTTTGTACCCATGTGATGG - Intronic
970808347 4:20062109-20062131 GACATTTTGAAGACATGTGATGG - Intergenic
971021258 4:22538439-22538461 ATAATTTTGAAGCCAGGTGATGG + Intergenic
971248809 4:24954452-24954474 ATCCTTTTAAATCCATGTGGAGG + Intronic
972419517 4:38873587-38873609 TTCCTTCTGAACCCTTCTGAGGG - Intronic
974928789 4:68336604-68336626 TTGATTCTGAAGCCATATGATGG + Intronic
975690058 4:76954071-76954093 TTCCTTTTGCAGACATAGGATGG - Intronic
975850716 4:78569174-78569196 TTTCTTTTGGAGGCATCTGAAGG + Intronic
976187580 4:82457981-82458003 TTCATTTTGAAGCCAATTTAGGG - Intronic
977689330 4:99887783-99887805 TTACATTGGAAGCCATGTGAAGG - Intronic
977931204 4:102750996-102751018 ATCATGTTGAAGCCAGGTGATGG + Intronic
978669975 4:111235872-111235894 TTCCCTTTGATGGCATGTCAAGG - Intergenic
982129938 4:152219650-152219672 TTCCTTCTGAAGCCCTATTAAGG - Intergenic
982457471 4:155627666-155627688 TACCTTTAAAAGCCATGTTAAGG - Intergenic
985839351 5:2294399-2294421 TCCTTTTTGAGGCCATGTTAGGG + Intergenic
985908627 5:2862222-2862244 TTCCTTAAGGAGCCATGTGAAGG - Intergenic
985980702 5:3460632-3460654 TTCCACTTGAAGGCTTGTGATGG - Intergenic
986604946 5:9513361-9513383 TTCCTTTTAAAGAAATTTGATGG - Intronic
986843985 5:11731955-11731977 TTCCTTTTGACTCCATGTTTTGG - Intronic
990808296 5:59691927-59691949 TTCATTATTAAGCCATATGAGGG + Intronic
994195526 5:96918580-96918602 TTCCTTTTGTATCTCTGTGAGGG - Exonic
995536027 5:113137375-113137397 TTCCTTTTGTATCCATTTTAGGG + Intronic
997659052 5:135576152-135576174 TTCCTGCTGATGCCAGGTGATGG + Intronic
998121035 5:139578007-139578029 TTTCCTTTGAAGCCTAGTGAGGG + Intronic
998525345 5:142837832-142837854 TTTCATCTGAAGCAATGTGAGGG - Intronic
998867050 5:146515909-146515931 TTCCTTTCCAAGCATTGTGAAGG + Exonic
999875823 5:155804591-155804613 AACATTTTGAGGCCATGTGATGG - Intergenic
1000592720 5:163177909-163177931 TTCCCTTTAAATTCATGTGATGG + Intergenic
1001651781 5:173320957-173320979 TTCCTTCTGAAGCCATGATGTGG - Intronic
1002972458 6:2037802-2037824 CTCCTTTAGAAACCATGTGCAGG - Intronic
1003349895 6:5306364-5306386 TTCTTTTAACAGCCATGTGATGG + Intronic
1003642642 6:7888476-7888498 TTCCTTTTGAAAACATGAAATGG - Intronic
1004541233 6:16552304-16552326 ATCCTTATGAAGCCATGTAGTGG + Intronic
1004557605 6:16714667-16714689 TTCCTTTGAAAGCTCTGTGATGG + Intronic
1005132221 6:22522386-22522408 TTCCCTTTGCAGCCCTGTGTAGG + Intergenic
1005886449 6:30101247-30101269 TTCCTAGTGTTGCCATGTGAGGG - Intergenic
1008449036 6:51628018-51628040 CTCCTTTTCATGCCATGTTATGG - Intronic
1008534845 6:52499911-52499933 TTCCTTTTGAAGGTAGGGGATGG - Exonic
1009327942 6:62377232-62377254 TTCCTTCTGAAGCCATGGGAGGG + Intergenic
1010024578 6:71200775-71200797 TTCCTTGTGAAACCATCAGATGG - Intergenic
1011081605 6:83495885-83495907 TTCCTTTTCTAGCCAAGGGAAGG + Intergenic
1012335192 6:98046910-98046932 TTCATTTTAAATCCATGTGAGGG + Intergenic
1013542986 6:111130288-111130310 TTCCTGTTAAACTCATGTGAAGG + Intronic
1014773436 6:125482578-125482600 TTCATTTTGAATCCAAGTGGAGG - Intergenic
1015231271 6:130917481-130917503 TTCTTGTTGAAGGCAGGTGAGGG - Intronic
1015243440 6:131051713-131051735 CATCTTTTGAAGCCATTTGAAGG - Intronic
1016286555 6:142480393-142480415 TTGATTTTGATGCCATGTTATGG + Intergenic
1017695131 6:157007179-157007201 TTCCATTTGAAGGCATGTGCGGG - Intronic
1017717946 6:157225113-157225135 GTCCATTTGAAGCCATCTAACGG - Intergenic
1018024774 6:159796177-159796199 TTCTTTTTTATGCCATATGAGGG + Intronic
1018233141 6:161695205-161695227 TTCCTTTTGTAGCCAGTTGGGGG - Intronic
1020119088 7:5492684-5492706 TTCCTTATAAGGCCAGGTGAAGG + Intronic
1021489996 7:21209207-21209229 TTCATTTTGTAACCATTTGAAGG - Intergenic
1021918455 7:25458864-25458886 ATCGTTTTGAGCCCATGTGAAGG + Intergenic
1022296623 7:29061614-29061636 TTCCTTTCTCAGCCATGTGAGGG - Intronic
1022389522 7:29931128-29931150 TTCCCTCTAAAGCCTTGTGAGGG + Intronic
1022433583 7:30354973-30354995 TTCCTTTTGAAAAAATGTTAAGG - Intronic
1023142681 7:37117970-37117992 TTGCTGTTGAAGCCATTTCAGGG + Intronic
1024099984 7:46021329-46021351 TTCTTTTAGAAGACATGTTAGGG - Intergenic
1024481475 7:49867719-49867741 GTACTTTTGTAGCCATGTAATGG - Intronic
1024803414 7:53107763-53107785 GTCCTATGGAAGCTATGTGAAGG + Intergenic
1025317503 7:58050461-58050483 TTGCTTTTGATGCCATTCGATGG - Intergenic
1025317791 7:58054141-58054163 TTCCATTTGATTCCATTTGATGG + Intergenic
1025317955 7:58056428-58056450 TTCCATTTGATTCCATTTGATGG + Intergenic
1025486305 7:61053400-61053422 TTCCATTTGAGTCCATTTGATGG - Intergenic
1025555474 7:62302342-62302364 TTCCATTAGAGGCCATTTGATGG - Intergenic
1025555709 7:62305486-62305508 TTCCATTTGATTCCATTTGATGG - Intergenic
1025559564 7:62354133-62354155 TTCCATTTGATTCCATTTGACGG - Intergenic
1025559894 7:62358539-62358561 TTCCATTTGAGTCCATTTGATGG - Intergenic
1025761773 7:64402571-64402593 TTGCTTCTGAAGCCAGGAGATGG - Intergenic
1026789799 7:73324300-73324322 ATCCTTTTGGTGCCAGGTGATGG + Intronic
1027677070 7:81173187-81173209 TTCATTATTAAGCCATATGAGGG - Intergenic
1028409138 7:90509090-90509112 TTTATTTTGAAGGAATGTGAAGG + Intronic
1028574151 7:92327771-92327793 TTCTTTTCAAAGCCATATGAAGG + Exonic
1029649193 7:101879294-101879316 TTCATGTTAAAGCTATGTGAAGG - Intronic
1031217319 7:118911671-118911693 TTCCTTTTAAAGACCTCTGAAGG - Intergenic
1034481953 7:151328680-151328702 TTCCTTTTGAAACCTGATGAAGG - Intergenic
1037914894 8:22767050-22767072 TTCCTCTTTAAGCCATACGAAGG + Intronic
1038088186 8:24223021-24223043 TTCCTGTAGGAGCAATGTGATGG + Intergenic
1039652017 8:39352521-39352543 TTCTTGCTGCAGCCATGTGAAGG + Intergenic
1040088922 8:43375775-43375797 TTCCTTATGAAACAATGTAAAGG + Intergenic
1040129559 8:43778933-43778955 GACATTTGGAAGCCATGTGAAGG + Intergenic
1040871995 8:52109471-52109493 CTCCTGTGGAAACCATGTGAGGG - Intergenic
1041595835 8:59650646-59650668 TTCCTTTTAAAAACATGTCATGG + Intergenic
1042180151 8:66079685-66079707 GTTCTCTTGAACCCATGTGATGG - Intronic
1043408874 8:79971014-79971036 TTCCTTTAGAAGCCACGAGAAGG + Intronic
1044155709 8:88843777-88843799 TTGCTTTTGTAGCCATCTGCTGG + Intergenic
1045982156 8:108203027-108203049 TTCCTTTAGAAGCCAGATGTTGG - Exonic
1046051153 8:109024328-109024350 GACCTTCTCAAGCCATGTGAGGG + Intergenic
1046408911 8:113813055-113813077 TTCACTATGAAGTCATGTGATGG + Intergenic
1046795437 8:118366372-118366394 TTGCCTTTGAAGTCATGTTAAGG - Intronic
1047063350 8:121252359-121252381 TTCCTTTTGAGCCCATGGTATGG - Intergenic
1048229938 8:132628614-132628636 TTCTTCTTGAAGCCTTGAGAGGG + Intronic
1049961147 9:739484-739506 CTCTTTTTGGAGCCATGTTAGGG + Intronic
1050263369 9:3864443-3864465 TGCATTTTGAAACCATGAGAAGG - Intronic
1050772087 9:9215166-9215188 TTCCTTTAGAAGTCATCTGCTGG + Intronic
1055446713 9:76391405-76391427 TTCCTTTTTAAACCACCTGAGGG - Intronic
1056718256 9:89051731-89051753 TTTCCTCTGCAGCCATGTGATGG - Intronic
1058934619 9:109757269-109757291 GTTCTCTTGAAGCAATGTGATGG - Intronic
1059806324 9:117804727-117804749 TGCCATTAGAAGCAATGTGAAGG - Intergenic
1203345935 Un_KI270442v1:34270-34292 TTCCTTTTGATTTCATTTGATGG - Intergenic
1187534485 X:20126912-20126934 TTCCTTTTGAAGCCATGTGAAGG + Exonic
1187733927 X:22285007-22285029 TTCCATTTGGAGCCTGGTGAGGG - Intergenic
1187755641 X:22522982-22523004 TTGCCTTTGAAGTCATGTGTTGG + Intergenic
1191803562 X:65107738-65107760 TCCCTTTTGCTGCCATGTGAAGG + Intergenic
1191903042 X:66058127-66058149 TTATTTTGGAAGCCATGTGCAGG - Intergenic
1191936935 X:66436826-66436848 GTCCTTTTGAGCCCAAGTGAGGG - Intergenic
1195284387 X:103369512-103369534 TTGTTTTTGAAGCCCTGAGATGG - Intergenic
1195356894 X:104047746-104047768 TTCCTGTTGAATATATGTGAGGG + Intergenic
1195457790 X:105089008-105089030 TTCCTTTAGAAGAGATGTGAAGG - Intronic
1198523980 X:137481253-137481275 TTACTGTTCAAGCTATGTGATGG - Intergenic
1201196761 Y:11501906-11501928 TTCCTTTTGAAACCATTGCATGG - Intergenic
1202607769 Y:26653531-26653553 TTCCATTTGATTCCATTTGATGG - Intergenic