ID: 1187537189

View in Genome Browser
Species Human (GRCh38)
Location X:20152747-20152769
Sequence TTATATGTTCACAAAATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187537189_1187537192 9 Left 1187537189 X:20152747-20152769 CCTTCCATTTTGTGAACATATAA 0: 1
1: 0
2: 3
3: 37
4: 369
Right 1187537192 X:20152779-20152801 CTCCAATAAAATTGGCTGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 110
1187537189_1187537194 14 Left 1187537189 X:20152747-20152769 CCTTCCATTTTGTGAACATATAA 0: 1
1: 0
2: 3
3: 37
4: 369
Right 1187537194 X:20152784-20152806 ATAAAATTGGCTGCTTGGCTAGG 0: 1
1: 0
2: 2
3: 28
4: 272
1187537189_1187537195 23 Left 1187537189 X:20152747-20152769 CCTTCCATTTTGTGAACATATAA 0: 1
1: 0
2: 3
3: 37
4: 369
Right 1187537195 X:20152793-20152815 GCTGCTTGGCTAGGCAAAGAAGG 0: 1
1: 0
2: 1
3: 6
4: 148
1187537189_1187537191 1 Left 1187537189 X:20152747-20152769 CCTTCCATTTTGTGAACATATAA 0: 1
1: 0
2: 3
3: 37
4: 369
Right 1187537191 X:20152771-20152793 TTGCTTTTCTCCAATAAAATTGG 0: 1
1: 0
2: 1
3: 50
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187537189 Original CRISPR TTATATGTTCACAAAATGGA AGG (reversed) Exonic
904458755 1:30663068-30663090 TCATTTGTTCACAATATGCATGG - Intergenic
905492076 1:38352503-38352525 TTATATATTCAAAATATGCAAGG + Intergenic
906891628 1:49722234-49722256 TTATATCTTCAGAAAAAGAAAGG - Intronic
907646621 1:56250979-56251001 TCATGTGTGCACAAAAAGGAAGG - Intergenic
907800082 1:57756143-57756165 TTATCTATTCAGAAAATTGAGGG + Intronic
907971273 1:59384011-59384033 TTTTGGGTTCACAAAGTGGAGGG + Intronic
908735608 1:67273196-67273218 TTATTTTTTCAGAGAATGGATGG + Intergenic
909495820 1:76277447-76277469 TTCTATATTCAAAAAATAGATGG + Intronic
909754851 1:79212394-79212416 TTATATTTTAACAAAGTGGATGG + Intergenic
910524018 1:88156695-88156717 TTATATGTTCCAACATTGGAGGG + Intergenic
911212521 1:95157553-95157575 TTATATTTTTAAAAAATGAAAGG + Intronic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
913030690 1:114899717-114899739 ATATATGTTCCCAAATTGTATGG - Intronic
915421160 1:155783033-155783055 TTATATGTTCCCAGGATGAATGG + Intronic
915666637 1:157451051-157451073 TTATATGGTCTAAAAATGGGAGG - Intergenic
915956857 1:160227847-160227869 TCATATGTTCAGAAAGTGGTAGG - Intronic
916968406 1:169979792-169979814 ACATATGTTCACCAAATGAAAGG + Intronic
917198862 1:172494877-172494899 TTTTAAGTTTACAAACTGGACGG - Intergenic
917504337 1:175614561-175614583 TGATATGTTCCCAGAAAGGAGGG - Intronic
918446304 1:184620538-184620560 TTATTTGCTAACAAAATGAAAGG - Exonic
919357776 1:196547667-196547689 TTATATGTAGATATAATGGATGG - Intronic
919375479 1:196788354-196788376 TTACATGTTTGCAAAATGGATGG + Exonic
919384652 1:196905246-196905268 TTACATGTTTGCAAAATGGATGG + Exonic
919385156 1:196912878-196912900 TTACATGTTTGCAAAATGGATGG + Exonic
921622860 1:217345409-217345431 TTAAATGTTCAGTAAATGGTAGG + Intergenic
922267921 1:224004269-224004291 ATATATGTACTCAAAATGAAAGG - Intergenic
1063805058 10:9629564-9629586 GTATTTGTTCACAAAAAGGTTGG + Intergenic
1063981140 10:11452828-11452850 TTAAATGTTCACATAGGGGAAGG - Intergenic
1065075088 10:22070292-22070314 TTATAGTACCACAAAATGGATGG + Intergenic
1065820365 10:29519522-29519544 TTTCATTTTCACAAAAGGGAGGG + Intronic
1066196627 10:33106527-33106549 TTATATGGGCACAAGATGGTGGG - Intergenic
1066725782 10:38391342-38391364 ATATATGTACTCAAAATGAAAGG + Intergenic
1067578456 10:47423134-47423156 TTATCTGTTCACAAAACAAACGG + Intergenic
1070273456 10:74981197-74981219 TTATTTGTTCACAAAGTAAAGGG + Intronic
1071221949 10:83477867-83477889 ATATATGTTAACATAATTGATGG + Intergenic
1071512995 10:86277117-86277139 TAAAATGTTCTCAAGATGGAGGG + Intronic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1074184339 10:111087841-111087863 ATATATTTTTAAAAAATGGAAGG - Intergenic
1075320819 10:121490578-121490600 TTATCTCTTCCCAAAATAGAAGG - Intronic
1075602812 10:123783073-123783095 TTATATGGTCTAAAAATGGAGGG + Intronic
1076486415 10:130821709-130821731 GTATATGTTCTCCAAATGAATGG + Intergenic
1081075504 11:38668038-38668060 TTATATGGGCACAAGGTGGAGGG + Intergenic
1081394592 11:42571249-42571271 TTATGTGTTCACAGAGTGGGAGG - Intergenic
1081790838 11:45783074-45783096 TGATATGTCCATACAATGGAAGG - Intergenic
1082015220 11:47480687-47480709 TTATATGTTCAGAAAATTCAGGG - Intronic
1083070986 11:59981068-59981090 TTATCACTTCACATAATGGATGG + Intergenic
1083416170 11:62527179-62527201 GTAGATGTTCCCAAATTGGAAGG - Exonic
1085214926 11:74821181-74821203 TTATTTTTTTAAAAAATGGAAGG - Intronic
1087397017 11:97611607-97611629 TTATATGGTCACCAGATGGGGGG + Intergenic
1087665244 11:101037926-101037948 TCAAATGTGCACAAAATGGCAGG + Exonic
1087693358 11:101347654-101347676 GTAAATGCTAACAAAATGGAAGG - Intergenic
1088455327 11:110027330-110027352 TTATGTGTTCAACAAATGAAAGG - Intergenic
1089722299 11:120437907-120437929 TTATTTGGTCTCAAAAAGGACGG - Intronic
1089995076 11:122898883-122898905 TTCTGTGTGGACAAAATGGAGGG - Intronic
1090497093 11:127223888-127223910 TCAGGTGTTCACAAAATGAATGG - Intergenic
1090693046 11:129205653-129205675 ATAGATGTTCAAAAAATGGAAGG + Intronic
1091677263 12:2500438-2500460 TTAAATGTTCACAAAATTTAAGG + Intronic
1091855651 12:3737283-3737305 TTGTGTGTTCAAGAAATGGAAGG + Intronic
1092642382 12:10528705-10528727 TTAAATGTTCATAAAATTTATGG + Intergenic
1092961386 12:13599571-13599593 TTATAAGTTCACTAAATTGTGGG - Intronic
1095157660 12:38878088-38878110 CTATATGTTCTAAAAAGGGAAGG + Intronic
1095191866 12:39267082-39267104 TTATATGCTGACAAAACTGAAGG + Intergenic
1095611461 12:44133446-44133468 TGAAATGTTCACAAGATGGGTGG + Intronic
1096868802 12:54580465-54580487 TTAGATGTTGACAAATGGGATGG - Intronic
1097641010 12:62182261-62182283 AAATATGTTCTCTAAATGGAAGG + Intronic
1098200844 12:68053949-68053971 TTAAATGTTAGAAAAATGGAGGG + Intergenic
1098474570 12:70885389-70885411 TTTTATGTTTACATTATGGATGG - Intronic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1098754504 12:74342341-74342363 CTATATATTTATAAAATGGAAGG - Intergenic
1099527809 12:83736878-83736900 TTTTAAGTTCACAAAAAGTAAGG - Intergenic
1099543827 12:83950861-83950883 TTTTATGGGCACAAAATGGGGGG - Intergenic
1099974889 12:89536073-89536095 GTATAAGATCACTAAATGGAGGG - Intergenic
1101120793 12:101577594-101577616 TTATATCTTCTCAAAAGTGATGG - Intronic
1101752278 12:107591719-107591741 TTATATCTCCACAAGATGGCAGG + Intronic
1103315148 12:120047952-120047974 TTGTATATTTCCAAAATGGAAGG + Intronic
1105929519 13:25039389-25039411 TTATATGTTGACCAATTAGAAGG - Intergenic
1106900402 13:34349517-34349539 ATCTGTGTCCACAAAATGGAGGG + Intergenic
1107242413 13:38252401-38252423 TTATCTGTTCCCAACATAGATGG - Intergenic
1107870359 13:44740846-44740868 TTTTATTTTTACAAAAAGGAAGG - Intergenic
1108784722 13:53882397-53882419 TTAAATGTTCAAAGAATTGAAGG + Intergenic
1108883757 13:55154553-55154575 TTAGATGTTCACAAAATTGTTGG + Intergenic
1109767215 13:66918035-66918057 TTAAATGTTCACAAAATCCCTGG - Intronic
1110058532 13:71010624-71010646 GTATGTGTTCACCAAATGAAAGG - Intergenic
1110301660 13:73936019-73936041 TTATATGCTCACAAATGTGAAGG - Intronic
1111069700 13:83149143-83149165 TAATATGTTTTCTAAATGGAGGG + Intergenic
1111086063 13:83376330-83376352 TTATATTTTCTAAAAATAGATGG + Intergenic
1111529362 13:89517039-89517061 TTCTATTTTCACAAAAGGAAAGG + Intergenic
1111537545 13:89623476-89623498 TTATATGTGCTCAATATGCATGG - Intergenic
1115182060 14:30639890-30639912 TTCTTTGTTAACAAAATGAATGG + Intronic
1116056449 14:39870229-39870251 TTATTTGGCCACTAAATGGAAGG - Intergenic
1116108839 14:40549519-40549541 TAGTATGTTGACAAGATGGATGG - Intergenic
1116738902 14:48730283-48730305 TTATATGTCCTGAACATGGATGG - Intergenic
1117769894 14:59123179-59123201 TTATAGTTTTACAAAATGTAGGG + Intergenic
1117929519 14:60825591-60825613 TTATATCTTCATAAAATAGATGG + Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1118806652 14:69243407-69243429 GTATATTTACACAAAATTGAAGG + Exonic
1118912311 14:70071867-70071889 CTTTTTGTTCACAAAATAGATGG - Intronic
1119955306 14:78791830-78791852 GAATATGTTCAGGAAATGGAGGG - Intronic
1120297349 14:82660039-82660061 TTGAATGTTCACAAAATCCATGG - Intergenic
1120520245 14:85519008-85519030 TTCTATGTTACCTAAATGGAAGG + Intergenic
1121705789 14:95992653-95992675 TTATCTTTTAACAAAATGTATGG + Intergenic
1121705879 14:95993299-95993321 TTATATGGTCTAAAAAGGGAAGG - Intergenic
1121809481 14:96869634-96869656 TTATATGTTCTTAAAAGGTATGG - Intronic
1202916452 14_GL000194v1_random:177635-177657 TTATATGTACACTAAATTTAAGG - Intergenic
1123874434 15:24609545-24609567 TTTCATGTTAACAAAATGGCTGG - Intergenic
1125366115 15:38918346-38918368 TTATATGTTCAACAACAGGATGG + Intergenic
1125620430 15:41056574-41056596 TTATATCTTCATAAAACAGAAGG - Intronic
1127052577 15:55100355-55100377 TAAAATGTTCACATTATGGATGG + Intergenic
1127616179 15:60688121-60688143 TGATATGTTTACCAAATGGAAGG + Intronic
1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG + Intronic
1128320787 15:66692375-66692397 TGATTTGTCCCCAAAATGGAAGG - Intergenic
1128583935 15:68830806-68830828 TTTAATGTTCAAATAATGGAGGG - Intronic
1129604993 15:77020532-77020554 TTAAATGGTGACTAAATGGATGG - Intronic
1130887430 15:88105656-88105678 TTATATGTTCATCAAAGGAAAGG + Intronic
1131708021 15:95019761-95019783 TTATATCTCAATAAAATGGAAGG - Intergenic
1132740829 16:1412160-1412182 TTATATATTCACAGACTGGCGGG - Intronic
1133608936 16:7415000-7415022 TTATATGATCACATAGTGAATGG + Intronic
1134403878 16:13938446-13938468 TGAGATGTTCACAAACTGGTTGG + Intronic
1136345752 16:29674620-29674642 GTATATGTTTACTGAATGGAGGG + Intronic
1136741454 16:32533357-32533379 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1138241296 16:55429321-55429343 TTATCTGTTCCCAATATTGAAGG + Intronic
1138279139 16:55759901-55759923 GTAAATGTTCACAGAATGGATGG + Intergenic
1138289397 16:55833778-55833800 GTAAATGTTCACAAAATGGATGG - Intergenic
1138929682 16:61637464-61637486 TTATTTGTTCACAATAGAGAGGG - Intergenic
1140582567 16:76249090-76249112 TAGTATGTTCACAAAATAGATGG + Intergenic
1203028149 16_KI270728v1_random:541877-541899 ATATATGTTCAGAAAAAAGAAGG + Intergenic
1203043572 16_KI270728v1_random:792554-792576 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1143245324 17:5480042-5480064 TTAAATACTCACAAAATAGATGG + Exonic
1144551802 17:16247429-16247451 TTATATATTTACAAAATATAAGG + Intronic
1145290807 17:21544338-21544360 TTAGATGTTCAAAAAGTGGTGGG - Intronic
1145980586 17:29008952-29008974 TGAAATCTTCACACAATGGATGG + Intronic
1146187400 17:30732652-30732674 TTACATATCCACAAAATGGGTGG - Intergenic
1146332457 17:31938049-31938071 TTACATATCCACAAAATGGGTGG - Intronic
1146556595 17:33830344-33830366 TTTTATTTTGACAAAAAGGAGGG - Intronic
1148726795 17:49798130-49798152 TTAAAGTTGCACAAAATGGATGG + Intronic
1149050610 17:52300155-52300177 TTCTATGTTCACAAAGGGCACGG - Intergenic
1149118376 17:53129212-53129234 TAATATGTTCACAAAATACTTGG - Intergenic
1149173407 17:53840933-53840955 ATATATGTTCAAAAATTGCATGG - Intergenic
1149386544 17:56148235-56148257 TTAAATGGAAACAAAATGGAAGG + Intronic
1149571575 17:57675961-57675983 TTTTCTGTTTCCAAAATGGAAGG - Intronic
1150313542 17:64149323-64149345 TTATATGTATACAAAATCAAAGG - Intronic
1150801264 17:68284881-68284903 TTATATGCTCACAAAATCTGAGG + Intronic
1150897243 17:69226619-69226641 TTCTATGTTTACAAAAAGCACGG + Intronic
1153232663 18:2954823-2954845 TTATATGTTGTAAAAATAGATGG - Intronic
1154336186 18:13466826-13466848 TTATATCTTCACATGGTGGAAGG + Intronic
1154405639 18:14087886-14087908 TAATCTGTTCACACAATGCATGG - Intronic
1154968737 18:21385724-21385746 TTATCAGGTAACAAAATGGAAGG + Intronic
1155575358 18:27239764-27239786 TTATATGGTCACCAAATTCATGG - Intergenic
1155738330 18:29252618-29252640 TAATATGTTCATAAATTGGCGGG - Intergenic
1155865375 18:30958401-30958423 CTATAACTTCGCAAAATGGAAGG + Intergenic
1156059835 18:33061447-33061469 TTTGATGTTGACAGAATGGAGGG + Intronic
1156417524 18:36912858-36912880 TTATTTGCTCCCAAAATGGTGGG + Intronic
1156775554 18:40783818-40783840 TGAAATGTTCAAAAAATGTAGGG - Intergenic
1157965433 18:52203427-52203449 TTATATTTACACAAAATAGGAGG + Intergenic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1159347360 18:67224400-67224422 TTCTATGTTCTCAAAATATATGG - Intergenic
1159379440 18:67637251-67637273 TTATATGGGCACAAGATGGGGGG + Intergenic
1159436143 18:68420299-68420321 ATATATTTTCAGAAAATTGAAGG - Intergenic
1160055584 18:75476718-75476740 TTATAAGTTCACAAAATGGCAGG - Intergenic
1160139792 18:76311266-76311288 TTAGATGTTCACAGAATTGTTGG - Intergenic
1160459256 18:79025399-79025421 TTCCATGTTCACAAATTGTAAGG + Intergenic
1163207889 19:15816889-15816911 TTTTGTGTTGACAAAATGGCTGG - Intergenic
925801511 2:7606714-7606736 CTTTATGTTCAGAAAATGTAAGG - Intergenic
925975911 2:9142028-9142050 TAATAGATTCACTAAATGGAAGG - Intergenic
926832850 2:16982434-16982456 TTATATGGCCACAAAAAGGAAGG - Intergenic
927745330 2:25614653-25614675 TACTATGTTCATAAAATGGAAGG + Intronic
927970262 2:27301502-27301524 GTATATGTTCTAAAAAGGGAAGG - Intronic
928605430 2:32941444-32941466 TTATATGAAAACAAAAGGGAAGG + Intergenic
929991675 2:46795146-46795168 TCATATGTTCACAAATAGGCAGG + Intergenic
930144677 2:47989877-47989899 TTCTATGTTCACAGAGTGGCCGG + Intergenic
930355436 2:50312826-50312848 TTATATGATCAGGAAATGGAGGG - Intronic
930449846 2:51521740-51521762 TTATCTTTTCACAAAATAAACGG - Intergenic
930498402 2:52178399-52178421 ATATATGTTCCCAAATTGTATGG + Intergenic
931670002 2:64638672-64638694 TTAAATGTTAACAAAATGAGGGG - Intronic
931959027 2:67461112-67461134 TTATATTTCCACAAAAGGGTTGG - Intergenic
933917995 2:87016077-87016099 TTTTTTGTTCAAAAAATGAAAGG - Intronic
934005000 2:87753837-87753859 TTTTTTGTTCAAAAAATGAAAGG + Intronic
935784003 2:106532657-106532679 CTATATGGTCTAAAAATGGAAGG - Intergenic
935885169 2:107610512-107610534 TTATAGGTTAAAAAAAAGGAGGG - Intergenic
937481384 2:122263592-122263614 TTATATGTGCACAACATGCAAGG - Intergenic
937515438 2:122649784-122649806 TTATATGCTTTCAAAATGCAAGG + Intergenic
937761405 2:125607875-125607897 GTATATGTACATAAAATAGATGG + Intergenic
938881923 2:135599158-135599180 TTACATATGCACAAAAAGGATGG - Intronic
939172899 2:138716261-138716283 TTATATCCCCATAAAATGGATGG + Intronic
939738284 2:145877051-145877073 CTATATGTTCACAAATTGGGTGG + Intergenic
940518365 2:154711149-154711171 TTATAAGTTGAAAAAATGAATGG - Intronic
942210642 2:173665837-173665859 TTATACGTTCAAAAAATGTAAGG + Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
944009206 2:194952797-194952819 TTAAATGTTCACAAAGTGGCTGG + Intergenic
944281264 2:197900722-197900744 TTGTATGTTTACAAAGTGAAAGG + Intronic
944341818 2:198610359-198610381 TAAGATGTTCAGAAATTGGAGGG - Intergenic
944888574 2:204091774-204091796 GTATATACTCACACAATGGAAGG - Intergenic
944891275 2:204119797-204119819 TTATATGATCTAAAAAGGGAAGG - Intergenic
944945159 2:204676055-204676077 TTATAAGTTCAAAGACTGGAAGG - Intronic
944969193 2:204972268-204972290 TTTTATTTTAACAAAATGGTAGG - Intronic
945671969 2:212813121-212813143 TTATATGTTCAAAATATTGTTGG + Intergenic
945743231 2:213688919-213688941 TCATATGTTCAAAAAATGAGAGG - Intronic
947031469 2:225800744-225800766 TTGTATCTTCACAGAATGGAAGG + Intergenic
947376882 2:229505040-229505062 TGATATGTTCATAACATGAAGGG + Intronic
947863785 2:233381655-233381677 TAATTTGTTCACAAAACGTAAGG - Intronic
948306051 2:236947733-236947755 TTCTATGTTCACAAAACACAAGG + Intergenic
1170884394 20:20327512-20327534 TAATATGTTTCCAAAATGGCTGG + Intronic
1170919019 20:20658113-20658135 TTTCAGATTCACAAAATGGATGG + Intronic
1172813000 20:37663747-37663769 TTATATGGTCTGAAAATGGAGGG - Intergenic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1175612481 20:60363341-60363363 TAATCTGTTCTCAAATTGGAAGG - Intergenic
1176307102 21:5129331-5129353 TTTTACGTTCACAGCATGGACGG + Intergenic
1176740488 21:10597042-10597064 TTAAATGTTCACAAAACTAAAGG - Intronic
1177274861 21:18896859-18896881 TTTTATGGTCGCAAAATAGAAGG + Intergenic
1177275120 21:18901186-18901208 ATATATTTCCACAAAATGCACGG + Intergenic
1177730012 21:25016593-25016615 TTGTTCTTTCACAAAATGGATGG - Intergenic
1177939801 21:27395447-27395469 TTATATCTTCAAAATATGCATGG + Intergenic
1178960548 21:37060720-37060742 TTATATTTTCACACAATGCAGGG - Intronic
1179154670 21:38839381-38839403 TTATATGATCACAGAATGAATGG + Intergenic
1179668643 21:42930056-42930078 TAATATGTGCCCAAAATGGTCGG + Intergenic
1179849957 21:44132699-44132721 TTTTACGTTCACAGCATGGACGG - Intergenic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1183920437 22:41163065-41163087 CTAGATGTTCCTAAAATGGATGG + Intronic
951217307 3:20037592-20037614 GTATATGTTCAATAAATGCATGG - Intergenic
951518423 3:23588068-23588090 TCATATGTTCTCAATATGAAAGG - Intronic
954879956 3:53827761-53827783 TTTCATGTTCGCAAATTGGAAGG + Intronic
954955376 3:54513997-54514019 TTATATGTGCGGCAAATGGAAGG + Intronic
955102846 3:55869012-55869034 TTATATGTTTATAATAAGGAAGG - Intronic
956600218 3:71012999-71013021 TTATATGATACAAAAATGGAGGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
958127949 3:89381790-89381812 TTGTGTCTTCACAAGATGGAAGG - Intronic
958833903 3:99121230-99121252 TTGTTTGTACACCAAATGGATGG - Intergenic
958859515 3:99429325-99429347 TTATTTGTAGACAAAATGCATGG + Intergenic
959030309 3:101291776-101291798 TTATATGTTCATAAGATGATTGG - Intronic
959153872 3:102642126-102642148 TTTTCTGTTCACATAGTGGAAGG - Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
961343938 3:126248800-126248822 TTATATGGGTACAAAATAGACGG + Intergenic
964512413 3:157467333-157467355 TTAGCTTTACACAAAATGGAAGG - Intronic
964610861 3:158613537-158613559 TTCTATCTTCACATAGTGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965185311 3:165455107-165455129 TTCTATGGGCACAGAATGGAGGG + Intergenic
965242461 3:166220013-166220035 TAATATGTTCTGAAAATGTATGG - Intergenic
965308584 3:167099751-167099773 TTATATGTTCACGGAGTGAAGGG + Intergenic
965495883 3:169398584-169398606 ATATATGGACACAAAATAGATGG - Intronic
965566800 3:170128285-170128307 TTGTATGTTCTCAAAACGTATGG - Intronic
966645357 3:182240537-182240559 TTGTAAGTACAGAAAATGGAGGG + Intergenic
967787891 3:193517204-193517226 TTACATGTCCACCAAATGGCAGG + Intronic
968927083 4:3555132-3555154 TTATAAGGTCTCAAAAGGGAGGG - Intergenic
969614304 4:8243355-8243377 TTATAAGGTCTCAAAAGGGAGGG + Intergenic
970560401 4:17276632-17276654 TTAGATGTTCAACAAATGTATGG - Intergenic
971283705 4:25266126-25266148 GTATATGCTAACAAAATGAACGG - Intronic
971770413 4:30888318-30888340 CTATATATTCACATAATAGAAGG + Intronic
974164148 4:58178687-58178709 TAATTTGTTCACAGATTGGAAGG - Intergenic
974206898 4:58715816-58715838 TTGTTTATTCAAAAAATGGAGGG - Intergenic
974673688 4:65063470-65063492 TTCTTTCTTCACAAAATAGATGG + Intergenic
974920200 4:68229779-68229801 TTAAATGTTCAGAAACTGGATGG - Intronic
975236862 4:72008885-72008907 CCATATGTTCACAAGAAGGAAGG + Intergenic
975634013 4:76427992-76428014 TTATATATACATAAAATTGAGGG - Intergenic
975838387 4:78448703-78448725 TTATTTTTTTACAAAATGCATGG + Intronic
975997956 4:80337714-80337736 TTAAAGGTTTCCAAAATGGAAGG + Intronic
976935961 4:90633129-90633151 TTATATCTTCTCAACCTGGAAGG + Intronic
977083090 4:92558520-92558542 TTATATTTTTAAAGAATGGACGG - Intronic
977412569 4:96686832-96686854 TTATAAGTTAAGAAAATGAAAGG + Intergenic
977474993 4:97494527-97494549 TTATATGTTTGATAAATGGAGGG + Intronic
977477679 4:97533738-97533760 TAGTAAGTTCACACAATGGAGGG - Intronic
977500898 4:97835290-97835312 CTATATGGTCTAAAAATGGAAGG + Intronic
977651179 4:99471399-99471421 ATAAATTTTCACAAAATGAAAGG - Intergenic
977752238 4:100623315-100623337 ATATATGTTCAAAAATTGTATGG - Intronic
978048735 4:104168229-104168251 TTATATCTTCACGTAGTGGAAGG - Intergenic
978834318 4:113129944-113129966 TTATAATTTCACAAAACAGAAGG - Intronic
979310068 4:119192764-119192786 TTAAGTGTTCAATAAATGGAAGG + Exonic
979335907 4:119462469-119462491 ATATATGTACTCAAAATGAAAGG - Intergenic
979838005 4:125397897-125397919 TTATATCCTAACTAAATGGATGG + Intronic
980490538 4:133521083-133521105 TTTTAGTTTCACAATATGGATGG - Intergenic
980722703 4:136718614-136718636 ATATATGTTCCCAAATTGTATGG + Intergenic
981501014 4:145451957-145451979 TTACATTTTCACAACTTGGAGGG - Intergenic
982079996 4:151779987-151780009 TTCTATCTTCTAAAAATGGAAGG + Intergenic
982912692 4:161164622-161164644 TAATCTGTTCACCAAATGGTAGG + Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
983757105 4:171352912-171352934 TTGTATCTTAACAAAAAGGAAGG + Intergenic
984123370 4:175773661-175773683 TTATATGTTAACAATTTGAATGG + Intronic
984142291 4:176018677-176018699 TTATATGTTTTCAAAATAAATGG + Intergenic
984994415 4:185415068-185415090 ATATATTTCCACTAAATGGAAGG - Intronic
986458370 5:7943111-7943133 TCCTGTCTTCACAAAATGGAAGG + Intergenic
987012297 5:13779914-13779936 TTTTATGTACAGAAAATAGAAGG - Intronic
987170269 5:15248922-15248944 TTATCTTTTCACATAATGCAAGG + Intergenic
987390661 5:17372196-17372218 TAATATATTTAAAAAATGGATGG + Intergenic
989281890 5:39654034-39654056 ATATATGTTCAAAAATTGAATGG + Intergenic
989949045 5:50275364-50275386 TTATATCGTCACATAGTGGAGGG + Intergenic
990342137 5:54834008-54834030 TTATTGGTTCACAGACTGGAAGG + Intergenic
990617635 5:57523568-57523590 TTGTTTATTCACAGAATGGAAGG - Intergenic
990812756 5:59747640-59747662 TTATTTTATCACAAAATAGAAGG + Intronic
990972278 5:61521644-61521666 TTATATTCTCAGAATATGGATGG + Intronic
991537255 5:67683637-67683659 TTCTATGTTCAGGAATTGGAAGG - Intergenic
992212951 5:74498070-74498092 TTATATGTTCAATAAATGTATGG + Intergenic
992465805 5:77002868-77002890 TTAGTTGATCACAAAGTGGAGGG + Intergenic
992983486 5:82202537-82202559 TTATCTGTACACAGAATTGAGGG + Intronic
993910110 5:93671271-93671293 TTAGTTGATTACAAAATGGATGG - Intronic
994248419 5:97508151-97508173 TCATATGTTAGCAACATGGATGG + Intergenic
994612816 5:102066427-102066449 TTATATGTTGAAAAAATAAATGG - Intergenic
994904909 5:105827407-105827429 TTATATGTAAACAAAATTAAAGG - Intergenic
996605415 5:125314937-125314959 TCATTTGGTCACAAAATGCAGGG - Intergenic
996973240 5:129398147-129398169 GTAAATGTTCACAAAAAGCATGG + Intergenic
998063416 5:139137050-139137072 TTACATTTCCACAAAGTGGAAGG - Intronic
1000415531 5:160980256-160980278 TTATATGGTCTAAAAAGGGAAGG + Intergenic
1001425773 5:171621365-171621387 GTAGGTGTTCAAAAAATGGATGG + Intergenic
1001949285 5:175804967-175804989 TTACATGTGAACAAAATGGAGGG - Intronic
1002552496 5:180006023-180006045 TTATTTATTTACAAAATGGCAGG + Intronic
1004046558 6:12030707-12030729 TTATATGTTCAAAGAACTGAAGG - Intronic
1004859314 6:19784945-19784967 TACCATGTTCACAAACTGGAAGG + Intergenic
1007091121 6:39185534-39185556 TTCCATGTTTACTAAATGGAGGG - Intergenic
1007110099 6:39308597-39308619 TTATTTGTTGAACAAATGGATGG + Intronic
1008483451 6:52009984-52010006 TTATTTCTTCACAAAATAAATGG - Intronic
1009640137 6:66324567-66324589 TTATATGATTACAAAATTGATGG + Intergenic
1010171934 6:72985307-72985329 TTAAATATTGAGAAAATGGAAGG + Intronic
1010986635 6:82432680-82432702 TCAAATGTTCACAAATGGGAAGG + Intergenic
1011203888 6:84870456-84870478 TTAAATGTTAGAAAAATGGAAGG + Intergenic
1011798708 6:90985066-90985088 ATATATTTACACAAAATGTATGG - Intergenic
1012150537 6:95745180-95745202 TTAAATCTTCAAAGAATGGAAGG - Intergenic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012763402 6:103332394-103332416 TTATATGGGCACAGAATGGGGGG - Intergenic
1012997799 6:105991110-105991132 TTATACTTTTACAAAATGAAAGG - Intergenic
1013233143 6:108174972-108174994 TTATATGTACAGAAAATACATGG + Intronic
1013515074 6:110877179-110877201 TTACATGTCCACAAAATGGATGG - Intronic
1014539307 6:122654359-122654381 TTTTGTGTTCAGGAAATGGAGGG - Intronic
1014689733 6:124548892-124548914 TTTCATGTTGGCAAAATGGATGG - Intronic
1015850905 6:137571149-137571171 TTTTAAGTTCACAAAATATAAGG - Intergenic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1018158878 6:161017603-161017625 TTAAATTTTCACAAAATAAATGG + Intronic
1020628292 7:10609847-10609869 TGAGGTGTTTACAAAATGGAAGG - Intergenic
1020677000 7:11194875-11194897 ATATATGTTCCCAAATTGTATGG + Intergenic
1021707423 7:23381525-23381547 TTATATGTTCATTAAAGTGATGG + Intronic
1021820745 7:24495161-24495183 TTATATGAGCACAGGATGGAGGG + Intergenic
1022071541 7:26920626-26920648 TTATGTTTTCACAGAATGTAAGG - Intronic
1022567531 7:31418120-31418142 TAATATCTTCAGAAAATGCAAGG - Intergenic
1023782226 7:43667412-43667434 ATATATGTTCCCAAATTGAATGG + Intronic
1024067899 7:45757402-45757424 ATATATGTACTCAAAATGAAAGG + Intergenic
1024484905 7:49906953-49906975 TTATATGTTTCCTAAATGCAGGG + Intronic
1025531287 7:61887946-61887968 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1026412742 7:70142050-70142072 TTAAATGTTGAGAAAATGAAAGG - Intronic
1027601273 7:80244537-80244559 TTACATGTTGACAGAATGGAGGG - Intergenic
1029325676 7:99806822-99806844 TGATGTATACACAAAATGGAAGG + Intergenic
1029663054 7:101976206-101976228 GTTTATGTTTACAAAATGAATGG - Intronic
1030425335 7:109369529-109369551 TTATTTGTTCACAAATTGTGGGG + Intergenic
1030908579 7:115217227-115217249 TTATATATTCCCAGAGTGGAAGG + Intergenic
1031015794 7:116575119-116575141 TTGTAAGTTCTCAAAATGGAGGG + Intergenic
1031465326 7:122102978-122103000 TAATATGTTCAAAAAATAAAAGG + Intronic
1033296146 7:140137978-140138000 TTTTATATTCACAAAATTAAAGG - Intronic
1034135874 7:148768940-148768962 TTTTATGCTCACAAGATGGGAGG + Intronic
1034855512 7:154542681-154542703 ATAAATGTTTATAAAATGGATGG - Intronic
1034893738 7:154862030-154862052 TTTGATTTTAACAAAATGGAAGG - Intronic
1035653916 8:1291215-1291237 TTACAGATTCACAGAATGGATGG + Intergenic
1035895108 8:3391132-3391154 TTATATGATCAGAAAAGGAAAGG - Intronic
1037307495 8:17521225-17521247 TTATATTTCAACAAAATGAAGGG + Intronic
1037612554 8:20488581-20488603 TTCTCTTTTCACAAAGTGGAGGG + Intergenic
1037844448 8:22270755-22270777 GTATATATTCACACAATGGATGG - Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040621308 8:49095864-49095886 GTATATGTTAACATATTGGAAGG + Intergenic
1040744805 8:50628623-50628645 TTATAAATTCACATAAAGGAAGG - Intronic
1040925053 8:52672108-52672130 TTATACCTTCAGAAAATAGAAGG - Intronic
1041556316 8:59160286-59160308 TTATTAGTTCACAACATAGATGG - Intergenic
1042301411 8:67286638-67286660 TTATATGTTTAAAGAATGCACGG + Intronic
1043077471 8:75720110-75720132 TTTTATGGGCACAAAATGGGGGG - Intergenic
1043462050 8:80470092-80470114 TTCTCTGTTCACAAAAGGGGTGG - Intergenic
1043489159 8:80730688-80730710 TTATAGCTTTAAAAAATGGAAGG - Intronic
1043528708 8:81125671-81125693 TTGTATGTTCACTCTATGGAAGG + Intergenic
1044264987 8:90171403-90171425 TTTTATCTTGAAAAAATGGAAGG - Intergenic
1044529934 8:93295806-93295828 CTATATGTTCAGGAAAGGGAAGG - Intergenic
1044939299 8:97324348-97324370 TTATATGTCAATAAAATTGAGGG - Intergenic
1046257001 8:111713233-111713255 TTACATCATAACAAAATGGAAGG - Intergenic
1046403183 8:113734838-113734860 GTATATATTCACAAAATGTATGG - Intergenic
1046913596 8:119656469-119656491 TTAAATGTTCAGCAAATGGTAGG - Intronic
1047138730 8:122110669-122110691 TTATATATTTACAAAACCGATGG + Intergenic
1047883122 8:129218385-129218407 TTTTATAGGCACAAAATGGAGGG - Intergenic
1051219666 9:14834772-14834794 ATATATGTTCAAAAATTGTATGG + Intronic
1051806876 9:21004530-21004552 CTATATGTTCACATGGTGGAGGG - Exonic
1051897401 9:22002525-22002547 TAATATTTTCAAAAAAGGGAGGG + Intronic
1053505316 9:38638141-38638163 TTATATGTTCACATAACTTAAGG - Intergenic
1053802004 9:41770520-41770542 TTATAAGGTCTCAAAAGGGAGGG - Intergenic
1054143263 9:61544769-61544791 TTATAAGGTCTCAAAAGGGAGGG + Intergenic
1054462973 9:65475650-65475672 TTATAAGGTCTCAAAAGGGAGGG + Intergenic
1054648082 9:67605911-67605933 TTATAAGGTCTCAAAAGGGAGGG + Intergenic
1054817926 9:69493541-69493563 TTATATCTTTATAAAATAGAAGG - Intronic
1055154817 9:73048710-73048732 TTATATGAGCACATAATGAAGGG - Intronic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1056333696 9:85544168-85544190 TTAAATATTCACAAGATTGAAGG - Intergenic
1056892428 9:90507938-90507960 TTATCAGTTCACAAAATACAAGG - Intergenic
1058940339 9:109807515-109807537 ATATATGTTCACATGGTGGAAGG + Intronic
1059186103 9:112272570-112272592 CTATCTGTTAAAAAAATGGATGG - Intronic
1059304824 9:113345947-113345969 ATATAGGTAAACAAAATGGATGG - Intergenic
1059641660 9:116222905-116222927 ATATATGTTTACAATGTGGAGGG - Intronic
1059804010 9:117778930-117778952 TTATAGGTACACAAAGTGAAAGG - Intergenic
1060245881 9:121945950-121945972 TTATATTTTCGAAAGATGGAAGG - Intronic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1187723506 X:22176866-22176888 TGGTATATTCACATAATGGAAGG - Intronic
1188080341 X:25831088-25831110 TCATATCTTTGCAAAATGGATGG - Intergenic
1188955040 X:36424156-36424178 TTATATGGTCTAAAAATGGGAGG + Intergenic
1189001508 X:36952479-36952501 ATATATGTTCAAAAATTGTATGG + Intergenic
1189219469 X:39358832-39358854 TTATATGTTGCCAAAATGTGGGG + Intergenic
1190722985 X:53166105-53166127 ATATATGTTCAAAAATTGTATGG + Intergenic
1193706938 X:84832720-84832742 TTAAATGTTCACACTGTGGAAGG - Intergenic
1194233287 X:91350432-91350454 GTATATGTACACTAAATGAATGG - Intergenic
1195741476 X:108069004-108069026 TTAAATGTTCAAAAACTGGAGGG + Intronic
1195848795 X:109259557-109259579 TTCCATGTTCACAGATTGGAAGG - Intergenic
1196257088 X:113533351-113533373 TTATATATACATAAAATAGAAGG + Intergenic
1196562080 X:117161637-117161659 TTGTATGTTCTCAAAATTGATGG + Intergenic
1197019339 X:121668037-121668059 ATATATGTTCTCAAAATTGAAGG - Intergenic
1197694645 X:129538025-129538047 TTAAATTTTCACAAAACCGATGG + Intergenic
1197698132 X:129572983-129573005 TTTTATTTTCACAACCTGGAAGG - Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198590470 X:138174852-138174874 CTATAGGATCACAAAAAGGAGGG + Intergenic
1198633045 X:138663650-138663672 TTATATGTTTACATAATGTTGGG - Intronic
1201510199 Y:14750956-14750978 TTATATTTTCCCAAAAAGAAAGG + Intronic
1201897736 Y:19011021-19011043 TTATATGTTGACAACATTAATGG - Intergenic