ID: 1187537448

View in Genome Browser
Species Human (GRCh38)
Location X:20155886-20155908
Sequence TCCTCTCAGTCTACATGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187537448 Original CRISPR TCCTCTCAGTCTACATGAGT AGG (reversed) Intronic
900684585 1:3939964-3939986 TCCTCCCAGTCTGCAGGAGCAGG - Intergenic
911746217 1:101444629-101444651 TGCTCACACTCAACATGAGTGGG - Intergenic
912551286 1:110487064-110487086 TGTTCTCAGTCTACATGAGTAGG + Intergenic
916192349 1:162191849-162191871 TTATCTAATTCTACATGAGTAGG - Intronic
916454269 1:164954323-164954345 TCCTATGAGCCTTCATGAGTGGG + Intergenic
923662883 1:235973644-235973666 TACTTTCAGTCTCCATGAATTGG + Intergenic
1063195658 10:3740205-3740227 TCCTCTCATACCATATGAGTGGG - Intergenic
1071358277 10:84819413-84819435 TCCTCCCAGTCAACATGGGATGG - Intergenic
1072088238 10:92101362-92101384 TCCTTTTAGTCTACATAAATTGG + Intronic
1073276143 10:102313256-102313278 TCTTCTGAGTACACATGAGTCGG + Intronic
1075852980 10:125603779-125603801 TCATCTCAGACTGCAGGAGTTGG - Intronic
1077696179 11:4394662-4394684 TCCTCTCTATCTTCATGAGTTGG + Intergenic
1078062116 11:8055048-8055070 TCCTCTCTGTCTAGCTGAGGGGG - Intronic
1079816807 11:25071004-25071026 TCGTGTCAGTTTACATGAATAGG - Intronic
1082304431 11:50553708-50553730 ACCTCTCAGTCTACATGTCATGG + Intergenic
1084741753 11:71144525-71144547 TCTTCTCAGTCCACCTGGGTTGG - Intronic
1089099157 11:115946389-115946411 TCCTCTCCTTCTACGTCAGTGGG - Intergenic
1099799156 12:87435326-87435348 CTCTCTCAGCCTACATGGGTTGG + Intergenic
1101742906 12:107514937-107514959 TCCTCTCAGTTAACATATGTTGG + Intronic
1105668419 13:22586399-22586421 TCCTGGCAGTCCAGATGAGTGGG - Intergenic
1106459382 13:29955516-29955538 TCCTCTGAGTCTGCATTGGTGGG + Intergenic
1110829682 13:80016646-80016668 TAATCTTAGTCTACATGAATTGG - Intergenic
1111261038 13:85740587-85740609 TCCTCTCAGGCTACATTTTTGGG - Intergenic
1114128545 14:19760692-19760714 TCCTCAGAGTATAGATGAGTGGG - Intronic
1114399958 14:22401005-22401027 TCTTCTCAGTCTAGCTGATTTGG - Intergenic
1115448744 14:33521901-33521923 TCCTCTCAGTTTACATTGGCTGG + Intronic
1116667064 14:47790868-47790890 TACTCTCAGTTTCCATGAGTTGG + Intergenic
1123571486 15:21614956-21614978 TCCTCAGAGTATAGATGAGTGGG - Intergenic
1123608105 15:22057547-22057569 TCCTCAGAGTATAGATGAGTGGG - Intergenic
1128694489 15:69750389-69750411 TTCTCTCAGTTTTCATGTGTTGG + Intergenic
1128958454 15:71974343-71974365 TGCTCACATTCAACATGAGTGGG + Intronic
1202980340 15_KI270727v1_random:349345-349367 TCCTCAGAGTATAGATGAGTGGG - Intergenic
1132471920 16:109379-109401 TCCTCTCAGTCTGAGAGAGTTGG - Intronic
1133763316 16:8817404-8817426 TCCTCTCTGTCTACAAGAAATGG - Intronic
1133859455 16:9580607-9580629 GCTTCTCAGTCTTCATAAGTGGG + Intergenic
1137976916 16:53039871-53039893 CACTCTCAGTTTACATGATTGGG - Intergenic
1138732247 16:59208244-59208266 GCCTCTCAATGTACATGAGAGGG + Intergenic
1139450759 16:67026838-67026860 ACCTCTAAGCCTCCATGAGTGGG + Intergenic
1139966114 16:70746363-70746385 ACATCCCAGTCTCCATGAGTGGG - Intronic
1140725089 16:77804703-77804725 TCCTCTCTCTCCTCATGAGTTGG + Intronic
1141550838 16:84805713-84805735 TCCTCTCCCCCTAGATGAGTGGG - Intergenic
1142680461 17:1544833-1544855 TCCTGTCAGCCTCCATGTGTGGG - Intronic
1143046716 17:4086772-4086794 TCCTCTCAGTTTGCATCAGTTGG - Intronic
1144516207 17:15919011-15919033 TCTTCTCAGTCTCCAGGAGGAGG + Intergenic
1147970736 17:44218317-44218339 ACCTCTCAGCCTTCCTGAGTGGG - Intronic
1152141453 17:78539403-78539425 TCCCCCCAATCCACATGAGTAGG + Intronic
1156548110 18:37986198-37986220 TCATCTCAGTCTATACCAGTAGG - Intergenic
1158177401 18:54672907-54672929 TCCTCTCAGTCTAAACAGGTGGG - Intergenic
1159747590 18:72257091-72257113 TCCTCTCTGTCTTCTTGAGCTGG - Intergenic
1160140490 18:76317572-76317594 TCATTAAAGTCTACATGAGTGGG + Intergenic
1162652325 19:12099245-12099267 ACCTCTCAGTCTACATGCCACGG - Intronic
1165094098 19:33401241-33401263 TTAACTCAGTCTCCATGAGTCGG + Intronic
1168198427 19:54793887-54793909 TCTTCTCACTCTACATGGGAGGG - Intronic
926213206 2:10886814-10886836 TCCTCTGAGTCTAGGTGAGATGG + Intergenic
927467839 2:23350499-23350521 GCCTCTCAGTCTCCCTGGGTGGG - Intergenic
927483899 2:23475732-23475754 TCCTCTCATGCTAAATGTGTGGG + Intronic
928279007 2:29927868-29927890 TCCTCCAAGTTTACAAGAGTGGG - Intergenic
928292034 2:30047740-30047762 TCTTCTCAGTCTTACTGAGTGGG - Intergenic
929338835 2:40787125-40787147 TCCTCTCAGGTTAAATGAATTGG + Intergenic
930238807 2:48914844-48914866 TCCCCTCAGTCTACAGGGGCTGG - Intergenic
933663056 2:84943369-84943391 TCCTCTCAGTCTTCATCGGGGGG - Intergenic
938707190 2:133942437-133942459 CACTCTCAGTCTACATGATTGGG - Intergenic
939757768 2:146135763-146135785 TCCTTTCAGTAAACATGTGTGGG + Intergenic
941415647 2:165217632-165217654 TGCTCTCAGTCAACATGATTTGG - Intergenic
942886109 2:180926143-180926165 TCCTCTCTGTCTGCCTGTGTGGG - Intergenic
947815448 2:233033632-233033654 TCCTCCTTGGCTACATGAGTAGG + Intronic
1172259574 20:33550939-33550961 TGCTGTCAAGCTACATGAGTTGG + Intronic
1172844173 20:37919914-37919936 TCCTCTCAGACTTGATGAGATGG - Intronic
1173186143 20:40841845-40841867 TCCCCTCAATCTACATTGGTGGG + Intergenic
1177954628 21:27582380-27582402 ACCTCTCAGGCTCCATGACTTGG + Intergenic
1178402894 21:32302555-32302577 TTATCTCAGTCTACAGGACTGGG + Intronic
1179515849 21:41906085-41906107 TCCTCCCAGAGTGCATGAGTTGG - Intronic
1180026248 21:45163878-45163900 TACTCTGAGTCTACAGGAGCAGG - Intronic
1183006556 22:34907700-34907722 TCCTCTCAGTATATATAAATGGG + Intergenic
1183490937 22:38115289-38115311 TGCTCTAAGTGTGCATGAGTGGG - Intronic
1184844264 22:47071486-47071508 CCCTTTCAGTCTTCCTGAGTCGG + Intronic
1185080785 22:48708357-48708379 TCCTCTCTGTCCCCCTGAGTGGG + Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953494970 3:43377995-43378017 TCCCCTCATACTCCATGAGTCGG - Intronic
953959772 3:47257786-47257808 TCCTCACAGTCTACATGACGAGG - Intronic
954259259 3:49426867-49426889 TGCTCACAGTCTAAATGAGTAGG + Intronic
954914290 3:54135744-54135766 TCATCTCCTTCTAAATGAGTAGG - Intronic
956906349 3:73769828-73769850 TCCTCTGTTTCTACATGGGTAGG + Intergenic
960818301 3:121697405-121697427 CCCTCTCAGTCTCACTGAGTGGG + Exonic
960969741 3:123130896-123130918 TCCTCCCAGTCAGCATGAATTGG + Intronic
961073797 3:123963040-123963062 TCCTCATAGACTACATGATTTGG + Intergenic
961309763 3:125988768-125988790 TCCTCATAGGCTACATGATTTGG - Intergenic
962326891 3:134441827-134441849 TGCTCACACTCAACATGAGTGGG - Intergenic
966130042 3:176627275-176627297 TTCTCTCAGTTCACATTAGTGGG + Intergenic
966420719 3:179731899-179731921 TGCTCTCAGTCTACAGGTATTGG - Intronic
967952396 3:194851411-194851433 TCCTCTCTGCCTCCATGAGCAGG + Intergenic
969037980 4:4271197-4271219 TACTCTCTATCTCCATGAGTTGG + Intronic
970118186 4:12722669-12722691 TCCTCTCAATCAACATTATTTGG - Intergenic
970793325 4:19885921-19885943 TCCTCTCTGTTTTCTTGAGTTGG + Intergenic
971598606 4:28564480-28564502 TCTACTAAGTCAACATGAGTAGG + Intergenic
976277976 4:83297727-83297749 TGTACTCAGTCTATATGAGTTGG + Intronic
986569615 5:9151610-9151632 TCCTATCTTTCTACAGGAGTAGG + Intronic
994796909 5:104315039-104315061 TCCACTAAGTCTTCCTGAGTTGG + Intergenic
998879078 5:146628895-146628917 TTCTCTCAGCTTACATGTGTTGG + Intronic
999012788 5:148060798-148060820 TCCTCTCATTAGAAATGAGTGGG - Intronic
999740050 5:154542983-154543005 TGCTCTCATCCTATATGAGTTGG + Intergenic
1003094365 6:3131062-3131084 TCCTCTCAGCCTGCAAAAGTGGG + Intronic
1003651343 6:7963358-7963380 TCCTCTCTGTTTCTATGAGTTGG - Intronic
1005861000 6:29900501-29900523 TGCTCGCTGTCAACATGAGTGGG - Intergenic
1008054433 6:46931588-46931610 TCCTCTCGGTCTCCTTAAGTTGG + Intronic
1008271888 6:49499874-49499896 TCCTCCCCGTCTACAGGTGTGGG + Intergenic
1008465268 6:51823169-51823191 TCCTCTCAGGCTACAACAGAAGG + Intronic
1009868793 6:69431317-69431339 TCCTATCAGCCTATATGATTGGG + Intergenic
1012662288 6:101916363-101916385 TGCTCTCAGTGTGCATGATTTGG + Intronic
1013664742 6:112335903-112335925 TCCTCTAACTCTACAGGAGCTGG + Intergenic
1015424796 6:133053193-133053215 TCCTCTCTCTCTACATCATTGGG - Intergenic
1019560144 7:1651783-1651805 TTCTCTGAGGCTACATGGGTTGG - Intergenic
1023811686 7:43916887-43916909 TCCCCTCTTTCTAGATGAGTAGG + Intronic
1033472427 7:141662121-141662143 TCTTCTCTGTTTACTTGAGTAGG - Exonic
1033609044 7:142947857-142947879 TCTTCTCATGCTGCATGAGTTGG + Intronic
1036446088 8:8822716-8822738 TCATCTCAGTCTCCCTGACTTGG - Intronic
1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG + Intergenic
1037526341 8:19727879-19727901 TCCCCTCAGACCACATGAGAGGG + Intronic
1038695455 8:29802382-29802404 TCTTTTCAGTCTAAATAAGTCGG - Intergenic
1044319011 8:90781094-90781116 TCCTCTCAGTCTGCATTGGGTGG + Intronic
1046190918 8:110792937-110792959 TGCTCACATTCAACATGAGTGGG + Intergenic
1047317062 8:123744637-123744659 TACTCTCAGTCCACATGGTTTGG - Intergenic
1048733662 8:137473049-137473071 ACATCTCAGTCTACATGACCGGG + Intergenic
1051057528 9:13005264-13005286 TCCACTCAGTCTCCAGGAGAGGG + Intergenic
1056811259 9:89765839-89765861 GCCTCTCAGTCTGCATGTGGAGG + Intergenic
1057740995 9:97711105-97711127 CCCTCTCAGGCTACAAGAGGGGG - Intergenic
1058575482 9:106396372-106396394 TTCTGTAAGTCTACATGAGCAGG - Intergenic
1061541520 9:131280094-131280116 TCATCTCAGTCTGCAGGAGAAGG + Intergenic
1187537448 X:20155886-20155908 TCCTCTCAGTCTACATGAGTAGG - Intronic
1189134470 X:38534276-38534298 ACCTCTCAGCCTGCCTGAGTGGG - Intronic
1189510469 X:41656652-41656674 TACTCACACTCAACATGAGTGGG + Intronic
1189516290 X:41716384-41716406 TGCTCACATTCAACATGAGTGGG + Intronic
1193453202 X:81696716-81696738 TAATCTCAGTCAAGATGAGTTGG + Intergenic
1196563421 X:117177542-117177564 TCCCCTCTTTCTAGATGAGTAGG + Intergenic
1196917626 X:120554812-120554834 CTCTCTCAATCTACCTGAGTGGG - Intronic
1197306404 X:124847166-124847188 TACTCTCAGTCACCAAGAGTGGG + Intronic
1198587998 X:138144179-138144201 TCAACTCAGTCTTCAAGAGTTGG - Intergenic