ID: 1187538395

View in Genome Browser
Species Human (GRCh38)
Location X:20165426-20165448
Sequence TGGAAAGGCCAGGATCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187538395_1187538401 1 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538401 X:20165450-20165472 GCTAGGAGCTTACACAGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 72
1187538395_1187538407 30 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538407 X:20165479-20165501 CAGAGAATAGGTTGAGAGATGGG 0: 1
1: 0
2: 1
3: 28
4: 319
1187538395_1187538403 3 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538403 X:20165452-20165474 TAGGAGCTTACACAGTTCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1187538395_1187538405 18 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538405 X:20165467-20165489 TTCTGGGGGAAGCAGAGAATAGG 0: 1
1: 0
2: 1
3: 50
4: 413
1187538395_1187538402 2 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538402 X:20165451-20165473 CTAGGAGCTTACACAGTTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 139
1187538395_1187538404 4 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538404 X:20165453-20165475 AGGAGCTTACACAGTTCTGGGGG 0: 1
1: 0
2: 2
3: 13
4: 196
1187538395_1187538406 29 Left 1187538395 X:20165426-20165448 CCCATGAGATCCTGGCCTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1187538406 X:20165478-20165500 GCAGAGAATAGGTTGAGAGATGG 0: 1
1: 0
2: 0
3: 32
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187538395 Original CRISPR TGGAAAGGCCAGGATCTCAT GGG (reversed) Intronic
902761324 1:18582695-18582717 TTCGAAGGCCAGGAACTCATGGG - Intergenic
904473310 1:30748866-30748888 TGGCCAGGCCAGGATCCCACAGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
907912035 1:58835380-58835402 TGTAAAGGCCTGAATGTCATTGG + Intergenic
909153243 1:72035612-72035634 TGGAGAGGCAGGGATCTCAGTGG + Intronic
912526772 1:110289336-110289358 TGAAAAGTCAATGATCTCATTGG + Intergenic
916465160 1:165066758-165066780 TGGTAAGGTCAGGATTGCATTGG - Intergenic
922818321 1:228467120-228467142 TGGGAAGACCAGCATCTCACTGG - Intergenic
923766852 1:236900474-236900496 TGGAAGGGACAGGAGCACATAGG + Exonic
924175418 1:241386624-241386646 TGGAGATGCCAGAATCTCCTTGG - Intergenic
1064166914 10:12994451-12994473 TAGAAAGTCCAGGAGCACATGGG + Intronic
1067463225 10:46473885-46473907 TGGGAAGGCCAGGCCCTTATCGG - Intergenic
1067473082 10:46549960-46549982 GGGAAAGGCCAGGATCCCTGTGG + Exonic
1068682494 10:59835309-59835331 AGGAAAGGCAAGGCTCTCACTGG + Intronic
1075572055 10:123553192-123553214 TGGAAAGGCCAAGCTTTCACAGG + Intergenic
1075932773 10:126313388-126313410 TGGAAGGGCAAGGATCACCTTGG + Intronic
1076471088 10:130718909-130718931 TGAAAAGGTCATGAGCTCATAGG + Intergenic
1077981860 11:7308952-7308974 AGGAAAGGCCAGAATCCCAGAGG - Intronic
1082102169 11:48181675-48181697 AGCAAAAGACAGGATCTCATTGG - Intergenic
1082980666 11:59117502-59117524 GTGAAAGGCCAGGCTCTTATGGG - Intronic
1084262442 11:67987989-67988011 TGAAAACGCAACGATCTCATGGG + Intergenic
1085581791 11:77657571-77657593 ATGAAAGGCAAGGATCTCTTGGG - Intergenic
1086152874 11:83632140-83632162 TGGAAGGCACAGGTTCTCATAGG - Intronic
1088717875 11:112564821-112564843 GGGAAAGTCCAGGGTCTGATTGG + Intergenic
1089406054 11:118198498-118198520 CGGAAAGGCCAGGAGCCCTTCGG - Intronic
1090667145 11:128922037-128922059 TGCAAAGGCCAGGAGCTCTGGGG + Intergenic
1090913390 11:131141397-131141419 TGCAAAGGCCATGAAGTCATAGG + Intergenic
1093273478 12:17095406-17095428 TGGAAAGTCTAAAATCTCATGGG + Intergenic
1093511596 12:19935896-19935918 TGGCAAGGCCATGTTCTCCTAGG - Intergenic
1094156584 12:27343778-27343800 AGAAAAGGCCAGCATTTCATAGG - Intronic
1094844537 12:34355679-34355701 TGGAAAGCCCAGGGTCCCCTGGG + Intergenic
1094844730 12:34356434-34356456 TGGAAGGCCCAGGGTCCCATAGG + Intergenic
1096953554 12:55502020-55502042 TGCAAAGGACATAATCTCATTGG - Intergenic
1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG + Intergenic
1097599557 12:61673733-61673755 TGGAAAGTCCAAGATCACAGTGG - Intergenic
1098437386 12:70482243-70482265 TGGGAAGCCCAGGGTCTCAAAGG - Intergenic
1102161766 12:110774852-110774874 TGGAAAAGCCAGGTTCCAATGGG - Intergenic
1104751811 12:131244892-131244914 TGGGAAGCCCAGGGTCACATGGG - Intergenic
1104780082 12:131414183-131414205 TGGGAAGCCCAGGGTCACATGGG + Intergenic
1105656596 13:22447589-22447611 TTGAAAGGCCAGCATGTCAGTGG - Intergenic
1112218481 13:97461167-97461189 TGTAAAGGAAATGATCTCATTGG + Intronic
1112441547 13:99427634-99427656 TGGGGAGGCCAGGAGCCCATAGG + Intergenic
1113107802 13:106790308-106790330 AGGAGAGGCAAGGATCTCAAAGG - Intergenic
1114409582 14:22488147-22488169 TGGAAATGCCAGGCTCTCAGAGG - Intergenic
1117010232 14:51463602-51463624 TGGCAAGGCCAGAACCTCTTAGG + Intergenic
1118383853 14:65239243-65239265 TGGAAAGGGCAGGATACCACTGG - Intergenic
1118905976 14:70023459-70023481 TTGAAAGGCCAGGAGCACAGGGG - Intronic
1119424109 14:74524771-74524793 TGGAAGAGCCAGGATCCCAGTGG + Intronic
1119595395 14:75928167-75928189 CGGCTAGGCCAGGATCTCAGAGG - Intronic
1119735128 14:76976728-76976750 TGGAAAGGAGAAGATCTCCTGGG + Intergenic
1119950771 14:78742212-78742234 TGGACAGGCCAAGATGCCATGGG + Intronic
1120034840 14:79684906-79684928 TGGGAAGGCCTGGATCACAGGGG + Intronic
1127290605 15:57567314-57567336 AGGAAAAGCCAGCATCTTATTGG - Intergenic
1129315127 15:74738022-74738044 TGCAAATGACAGGATCTCATTGG - Intergenic
1131279225 15:91007281-91007303 AGCAAAAGCCAGGATCTCCTGGG - Intronic
1138389215 16:56658030-56658052 TGGAAAGTCCAGTCTCTCCTCGG + Exonic
1141226055 16:82116455-82116477 GAGACAGGCCAGGATCACATAGG + Intergenic
1142888056 17:2925607-2925629 TGAAAAGGCCAGGAATTCCTTGG + Intronic
1148173179 17:45540981-45541003 TGCAAAGACCAGCATCTCCTGGG + Intergenic
1148276088 17:46304470-46304492 TGCAAAGACCAGCATCTCCTGGG - Intronic
1148298206 17:46522046-46522068 TGCAAAGACCAGCATCTCCTGGG - Intronic
1148362746 17:47026516-47026538 TGCAAAGACCAGCATCTCCTGGG - Intronic
1149302136 17:55315309-55315331 TGGAAAGGGCAAGATCTGCTGGG - Exonic
1149534860 17:57425048-57425070 TGGAATGGCCTGGAAATCATGGG + Intronic
1150404385 17:64887898-64887920 TGCAAAGACCAGCATCTCCTGGG + Intronic
1152108296 17:78343085-78343107 TGGAAAGACCAGCATGTCCTTGG + Intergenic
1153518750 18:5931843-5931865 TGGCAAAACAAGGATCTCATGGG + Intergenic
1154139561 18:11811097-11811119 TGGCAAGGCCCGGATTTCAATGG - Intronic
1155410944 18:25544078-25544100 GGGAAAGGGAAGGAACTCATGGG - Intergenic
1158000095 18:52608394-52608416 TGGGAAGGCCAGGTCCTCAGTGG - Intronic
1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG + Intergenic
1160058460 18:75508462-75508484 AGAATAGGCCAGGCTCTCATGGG + Intergenic
1164829672 19:31310920-31310942 TGACAAGGCCAGGATCTCTAGGG + Intronic
1166438751 19:42791941-42791963 TGCAAAGTCCAGGATCCCAGAGG - Intronic
1166473765 19:43102729-43102751 TGCAAAGTCCAGGATCCCAGAGG - Intronic
1166494547 19:43289666-43289688 TGCAAAGTCCAGGATCCCAGAGG - Intergenic
1168257572 19:55175084-55175106 TGGAAAGCCTATGATCTGATTGG + Intronic
926546086 2:14242076-14242098 TGGAAAAGGCTGGATCTCTTGGG - Intergenic
927013287 2:18928877-18928899 TAGAAATGCCAGGATCTAAATGG - Intergenic
927821170 2:26266457-26266479 TTGGAAGGCCAGGTTCTTATGGG + Intronic
928238617 2:29567322-29567344 TGGAAAGGCCAGTATTTCTGGGG - Intronic
928265286 2:29806153-29806175 TGGAAAGGCCTGAATCCCTTAGG + Intronic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
935221163 2:101014447-101014469 TGCAAAGGTCAGCATCTCACAGG - Intronic
935736150 2:106107974-106107996 TGGAAAGGCGTGGATCCCGTGGG + Intronic
936463174 2:112726287-112726309 CAGAAAGGCCAGGGTCTCACTGG - Exonic
939030114 2:137063833-137063855 TGCAGATGACAGGATCTCATTGG + Intronic
939167587 2:138655858-138655880 TGTAGAGGTCAGAATCTCATGGG - Intergenic
940189137 2:151020177-151020199 TGCAAAGGACATGATCTCATTGG + Intronic
942192377 2:173483001-173483023 TGTAAATGACAGGATCTCATAGG + Intergenic
944184078 2:196928208-196928230 TGGAAAGACCAGGATAACAGGGG + Intergenic
944741849 2:202620171-202620193 GGGAAATGCCAGGAAATCATAGG + Intergenic
947671707 2:231941060-231941082 AGCAAAGGCCAGGCTCTCACGGG - Intergenic
948902050 2:240960997-240961019 TGGGAAGGTCAGGCTCTCAGAGG + Intronic
1170122762 20:12928046-12928068 GGGAAGGGCCAGGTTCTCACTGG + Intergenic
1170174787 20:13456948-13456970 TGCAAAGGACATGAACTCATAGG - Intronic
1170479543 20:16752553-16752575 TGGAAAGGCCAGGAAGTGAGAGG - Intronic
1171188938 20:23144708-23144730 AGGCAAGGCCAGGCTCTCCTTGG - Intergenic
1173114599 20:40228704-40228726 TGGAAAGGAAAGGAGCTAATAGG + Intergenic
1175572565 20:60035090-60035112 TTGACAGGGCAGGATCTCTTAGG - Intergenic
1176751485 21:10694600-10694622 TGGAAAGGCCAGGAATTGAATGG - Intergenic
1179623297 21:42632799-42632821 TGGACAGGCCATGACCTCACTGG - Intergenic
1179878137 21:44281811-44281833 TGGAAGGGCCAGGCTCCCAGAGG - Intergenic
1181697754 22:24602364-24602386 TGGAGGGGCCAGGATTTGATGGG + Intronic
1182424859 22:30266577-30266599 TGGAGATGCCAGGTTCTCAGTGG + Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1184444385 22:44538974-44538996 TGGAAAGGCCAGGATCTGCCTGG - Intergenic
1184669477 22:46005319-46005341 TGGAAATGCCAGGACCCCAGGGG + Intergenic
951038611 3:17963116-17963138 TGGAATGGCCAGCTTCTCATTGG + Intronic
953438670 3:42899498-42899520 TGGAAATGGCAGGCACTCATTGG + Intronic
954590537 3:51778216-51778238 TGGGAAGGCCAGGATTCCACAGG - Intergenic
954814513 3:53270156-53270178 TGGAGAGGCCTGGAACTCCTCGG + Intergenic
954902409 3:54031167-54031189 CAGAAAGTCCTGGATCTCATAGG - Intergenic
955202242 3:56861671-56861693 CGGAAAGGCCTGGATCTGCTGGG + Intronic
955219171 3:57009550-57009572 TGGACAGGCCAGGATGTGAAGGG + Intronic
957077864 3:75615878-75615900 TGAAAACGCAACGATCTCATGGG + Intergenic
960147888 3:114222294-114222316 TGGAAAGGCAAAGATATCTTAGG - Intergenic
962371791 3:134826806-134826828 GGGAAAGGCCAGGGTGGCATAGG + Intronic
963324239 3:143843596-143843618 TGGGAAGGCCAGGAAGTCAAAGG + Intronic
966120257 3:176512397-176512419 TGCAAAGTCCAGGATCTCCAAGG - Intergenic
969020942 4:4139886-4139908 TGAAAATGCAACGATCTCATGGG + Intergenic
969333141 4:6491516-6491538 TGGCAAGGCCAGGCCATCATGGG + Intronic
969732910 4:8967538-8967560 TGAAAACGCAACGATCTCATGGG - Intergenic
969792491 4:9501617-9501639 TGAAAATGCAACGATCTCATGGG - Intergenic
970389765 4:15596177-15596199 TGGAAAGGCCAGGATATGGAAGG - Exonic
971318225 4:25584751-25584773 TGGGAAGACCAGAATCTCCTGGG + Intergenic
972388427 4:38590066-38590088 TGCAAAGCCTAGGATCCCATCGG + Intergenic
973551985 4:52044765-52044787 TGGAAAGGAAAGGATGTGATTGG - Intergenic
974681876 4:65175580-65175602 TAGAAAGGTGAGGATCACATTGG + Intergenic
976783260 4:88785951-88785973 GGGAAAGGCTAGGGTTTCATGGG + Intronic
979721286 4:123903707-123903729 TGGTAAGGCCAGTAGCTCACTGG + Intergenic
979905761 4:126289383-126289405 TGCAAATGACAGGATCTAATAGG - Intergenic
980983337 4:139672421-139672443 TGGAAAGGCCAATGACTCATGGG - Intronic
982389630 4:154850273-154850295 TTAAAAGGCCAGGATGTCAGTGG - Intergenic
984270023 4:177538260-177538282 TGCAAAGGGCATGAACTCATAGG - Intergenic
986497809 5:8364289-8364311 TGGAAAAGCCGGTATATCATAGG + Intergenic
990175847 5:53107535-53107557 TGGAAAGGCCATGTACTGATTGG - Intronic
991354984 5:65759514-65759536 TGGAAAGTCCAGAATCTCAGTGG + Intronic
992757944 5:79926610-79926632 TGGAAAGGCCAGAGTCTTCTGGG - Intergenic
997612213 5:135223135-135223157 GGGAAAGACCAGGGTCTTATGGG + Intronic
998640371 5:144003577-144003599 TGGAAAGTACAGGGTATCATGGG + Intergenic
1001135833 5:169101941-169101963 GGGAAAGGCCAGGATCTCTGAGG - Intronic
1001482738 5:172099821-172099843 TGGAAACACCAGGTTTTCATCGG + Intronic
1001712947 5:173792696-173792718 TGGAAAGGAGAGGATTTCACTGG - Intergenic
1001761203 5:174209917-174209939 TGGCAAGGCTGGGGTCTCATGGG + Intronic
1002254450 5:177948898-177948920 GAGAAAGTCCAAGATCTCATGGG - Intergenic
1002483543 5:179518914-179518936 GAGAAAGTCCAAGATCTCATGGG + Intergenic
1002881129 6:1253742-1253764 TGGTCAGGACAGGATCTCAAGGG - Intergenic
1003161514 6:3638564-3638586 TTTAAAGGCCAAGATCTCAGGGG + Intergenic
1004260485 6:14103221-14103243 AGCAAAAGCCAAGATCTCATCGG - Intergenic
1007979002 6:46130764-46130786 TGGGAATGCTATGATCTCATAGG - Intronic
1008616974 6:53235892-53235914 TGGACAGGCCAGGATGTTTTGGG + Intergenic
1010693027 6:78933114-78933136 TTCAAAGGACAGGCTCTCATTGG - Intronic
1013291319 6:108721123-108721145 TGGAGAGGAAAAGATCTCATCGG - Intergenic
1014808537 6:125858978-125859000 TGAAAATGGGAGGATCTCATTGG + Intronic
1017386932 6:153896793-153896815 TGGACAGGCCATAATCGCATTGG - Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1020308367 7:6851911-6851933 TGAAAACGCAACGATCTCATGGG + Intergenic
1022467127 7:30659456-30659478 TGGGAGGGAAAGGATCTCATGGG + Intronic
1028221039 7:88197008-88197030 TTGAAAGGCCAATATCCCATAGG + Intronic
1029860350 7:103564672-103564694 TGGAGAGGCAAGGATCTCGGGGG + Intronic
1030442439 7:109604208-109604230 TGGAAAGACCAGGATACCAAAGG + Intergenic
1031993298 7:128211577-128211599 TGGGAACGCCAGGCTCTCAGGGG + Intergenic
1031996798 7:128238009-128238031 AGGAAAAGCCAGGATCACACAGG - Intergenic
1033215398 7:139489937-139489959 TGGGAAAGCCAGCATGTCATTGG + Intergenic
1035681665 8:1493017-1493039 AGAAAATGCCAGGATCTCAGGGG + Intergenic
1040277150 8:46019507-46019529 TGGAAAGGCCCGGGCCTCCTGGG + Intergenic
1041494851 8:58474365-58474387 TAGCAAAGCCAGAATCTCATAGG - Intergenic
1042801160 8:72719272-72719294 TGGAAAAGTCAGGATTTAATGGG - Intronic
1045059079 8:98396556-98396578 TGAAAATTCCAGGATCTCAATGG - Intergenic
1049361368 8:142213887-142213909 TGGAAAGGCCAGGGCTTCCTGGG - Intronic
1050249847 9:3733341-3733363 TGGCACGGGTAGGATCTCATGGG + Intergenic
1051220483 9:14843389-14843411 AGGAAAGCCCAGGAAGTCATGGG - Intronic
1051603049 9:18893196-18893218 TGGAAAAGCCTGCTTCTCATAGG + Intronic
1053185619 9:36013709-36013731 TAGAACTGCCAGGATCTCACAGG - Intergenic
1057096070 9:92311026-92311048 TGGCAAGCCCTGGGTCTCATTGG + Intronic
1057194318 9:93108348-93108370 TGGAAAGCCCAGCATGTCACAGG + Intronic
1061109943 9:128561766-128561788 TGCAAAGGCCAGGATGACCTGGG - Intronic
1185556037 X:1022041-1022063 TGCAAAGGATATGATCTCATGGG - Intergenic
1186934935 X:14438750-14438772 AGGAAAGCCCAGGACCTGATGGG - Intergenic
1187218086 X:17296481-17296503 AGGAGAAGCCAGGATCTTATGGG - Intergenic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic
1187790157 X:22941833-22941855 TGGAAAGGCCTGGAACTCACGGG - Intergenic
1188410041 X:29860673-29860695 TGCAAAGGACATGAACTCATCGG + Intronic
1188758389 X:33993922-33993944 TGCAAAGGACATGATTTCATTGG + Intergenic
1188831959 X:34909364-34909386 TGCAAATTACAGGATCTCATTGG + Intergenic
1189552946 X:42112611-42112633 TGCAAAGGACATGAACTCATTGG + Intergenic
1192708361 X:73552285-73552307 TGCAAAGGCCATGATTTCAAGGG - Intergenic
1193756362 X:85413846-85413868 TGAAAAGTCCAGGACCTGATGGG - Intergenic
1193843422 X:86438197-86438219 TGCAAAGGACATGATCTCGTAGG + Intronic
1194507076 X:94745984-94746006 TGGAAAGGCCTGGATGTCCAGGG + Intergenic
1196331700 X:114478231-114478253 TGCAAATGACAGGATTTCATTGG + Intergenic
1199748856 X:150795371-150795393 TAGTAAGGCAAGGATCCCATGGG - Intronic
1201412738 Y:13716920-13716942 TGGAAAGACCTAGAACTCATTGG + Intergenic