ID: 1187543690

View in Genome Browser
Species Human (GRCh38)
Location X:20225883-20225905
Sequence CAGAAGATGGAAAAGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 0, 2: 13, 3: 69, 4: 723}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187543685_1187543690 7 Left 1187543685 X:20225853-20225875 CCAGAAGAAAGGATAACAGCATT 0: 1
1: 0
2: 3
3: 30
4: 475
Right 1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG 0: 1
1: 0
2: 13
3: 69
4: 723
1187543683_1187543690 18 Left 1187543683 X:20225842-20225864 CCTTTAGAAAGCCAGAAGAAAGG 0: 1
1: 0
2: 1
3: 29
4: 289
Right 1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG 0: 1
1: 0
2: 13
3: 69
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187543690 Original CRISPR CAGAAGATGGAAAAGAAGTG GGG Intronic
900760988 1:4470223-4470245 AATAAGATGGGAAAGCAGTGGGG - Intergenic
902782840 1:18715932-18715954 AAGAAGATGGGAAATGAGTGTGG - Intronic
903225879 1:21894114-21894136 CAGAACATGGAAAGAAACTGGGG + Intronic
903467447 1:23561753-23561775 TAGAGGAAGGAAAAGAAGGGAGG - Intergenic
903992523 1:27283605-27283627 AAGAACATGGAAGAGAAATGAGG - Intronic
904130426 1:28271776-28271798 CAGAAGCTGGTAAAGTAGTCAGG - Exonic
904364829 1:30003626-30003648 TAGGAGATTGGAAAGAAGTGGGG - Intergenic
904413734 1:30342322-30342344 CAGAAGACGGTGAAGAAGTGAGG - Intergenic
906228809 1:44142849-44142871 CAGGGGATGAAAAAGATGTGAGG - Intergenic
907735226 1:57105604-57105626 GAGAAGAAGGGAAAAAAGTGGGG - Intronic
908191230 1:61705641-61705663 CAGCAGATGGGAAAGAGGAGAGG - Intronic
908808181 1:67952212-67952234 GAGGAGATGGGACAGAAGTGGGG - Intergenic
908993190 1:70119263-70119285 CAGAGGAGGGCAAAGAAGAGAGG - Intronic
909068076 1:70960453-70960475 CAAAAGGTGAAAAAAAAGTGAGG + Intronic
909311445 1:74155120-74155142 CAGAAGATAGAAATGAAATTTGG - Intronic
909439911 1:75685695-75685717 CAGAAGAAGAAAGAAAAGTGTGG - Intergenic
910562688 1:88609076-88609098 AACAAGATGGAAAAGCATTGAGG - Intergenic
910928135 1:92417127-92417149 GAGAAGAAGGAAAATAAGTCTGG + Intergenic
910981595 1:92963803-92963825 AAGAAGATTGAAAAAAAATGGGG + Intergenic
911204464 1:95078510-95078532 AAGAAGATGGAAAAGAAAAGGGG + Intergenic
911242680 1:95483023-95483045 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
911506912 1:98764146-98764168 CAGAAGAAAGAAAAGTACTGGGG + Intergenic
911697992 1:100915158-100915180 AAGAAAAAAGAAAAGAAGTGAGG - Intronic
911950793 1:104171997-104172019 CAGAAAATGAGAAAAAAGTGTGG - Intergenic
912086506 1:106013122-106013144 CAGGAGCAGGAAACGAAGTGGGG + Intergenic
912252666 1:108027412-108027434 CTGAAGATGGAAAAGAGTAGTGG + Intergenic
912557002 1:110523782-110523804 CAGAAGATGGGAAAGCATAGGGG - Intergenic
913217690 1:116634382-116634404 GTGAGGATGGGAAAGAAGTGGGG - Intronic
913364376 1:118020020-118020042 CAGAAGGTGAAATATAAGTGTGG + Intronic
913441547 1:118903644-118903666 TAGAAGATGGAAAAGGACTAAGG + Intronic
913529240 1:119721806-119721828 CAGAAGGTGGCAGGGAAGTGGGG - Intronic
913655176 1:120953095-120953117 CAAAAGCTGGAAAAGAAGCAGGG + Intergenic
914645361 1:149647256-149647278 CAAAAGCTGGAAAAGAAGCAGGG + Intergenic
914974212 1:152344212-152344234 TAGAACATAGAAATGAAGTGTGG + Intergenic
915170254 1:153972705-153972727 GAGAAGATGCAATAGGAGTGAGG - Intronic
915403797 1:155643839-155643861 CATAAGAGGGAAAATAATTGAGG + Intergenic
915626969 1:157119861-157119883 CAGCATGTGGAAAAGAAGTAAGG - Intergenic
915729152 1:158040806-158040828 GATAAGATGGAAAAGAAGTTGGG + Intronic
916343122 1:163758674-163758696 AAGAGGAAGGAAAAGCAGTGTGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916620380 1:166490237-166490259 CAGAAAAAGGAAAAGACGAGGGG - Intergenic
916665120 1:166959563-166959585 CAAAAGAAGGAAAAAAAGTGGGG + Intronic
917039172 1:170784136-170784158 CAAGAGATGGAAAACAAGTAAGG - Intergenic
917609009 1:176667395-176667417 CAGAAAAATGAAAGGAAGTGGGG + Intronic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
918224934 1:182472647-182472669 TAGAAGATGGAAAGAAGGTGGGG - Intronic
918409121 1:184240419-184240441 CAGAAGATTGTACAGATGTGAGG + Intergenic
918608671 1:186460668-186460690 CCCAAGTTGGAAAAGGAGTGCGG - Intronic
918636577 1:186781870-186781892 CAGAATTTGGAAATGCAGTGGGG - Intergenic
919246338 1:194990613-194990635 CAGAAAAAGGAAAGGAAATGAGG + Intergenic
919325287 1:196099610-196099632 GAGAAGATGGAAAAGTGGGGGGG + Intergenic
920447328 1:206028609-206028631 TAAAAGATGGAAAAGGAGGGAGG - Intergenic
920878757 1:209861102-209861124 CAGTGGATGGAAAAGAAGTTAGG - Intergenic
921302890 1:213767388-213767410 CAGAAGATGGGGAGGAAATGTGG - Intergenic
922066717 1:222151174-222151196 CAGATGATGGAGAGGATGTGGGG + Intergenic
922253915 1:223874959-223874981 AAAAAGAAAGAAAAGAAGTGAGG + Intergenic
922987207 1:229874980-229875002 CAGGAGCTGGAGAGGAAGTGGGG + Intergenic
922995266 1:229952455-229952477 TAGAAGATGGAATAAAAATGAGG + Intergenic
923057525 1:230438333-230438355 CAGTAAATGGAAAAGAGTTGTGG - Intergenic
923220209 1:231886025-231886047 CAGAAGGTGGAAAGGCAGAGAGG + Intronic
923924414 1:238608412-238608434 CAGAAGGGGGACAAGAAGGGAGG + Intergenic
924088471 1:240478533-240478555 AAAAAGATGCAAACGAAGTGAGG + Intergenic
924606183 1:245537502-245537524 CAGAAGATGGCAGACAAGTTAGG + Intronic
1063256510 10:4333577-4333599 CAGAAGATGCAAATGATGTTAGG - Intergenic
1063366660 10:5494830-5494852 CAGAAAAAGGAACAGAAGTGTGG + Intergenic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1064429604 10:15259330-15259352 CAGTAGATGAAAAGGGAGTGAGG - Intronic
1064614886 10:17142666-17142688 CAGAAGAGGGAACTGAAGTCTGG - Intronic
1064720821 10:18226914-18226936 GGGAATATGGAAAAAAAGTGGGG + Intronic
1064938460 10:20706448-20706470 CAGAAGATAGAACAGAAGGTTGG - Intergenic
1065065755 10:21962090-21962112 GAGAAGAGGGATAGGAAGTGTGG - Intronic
1065438661 10:25727062-25727084 CGGAAGATGCCAGAGAAGTGAGG - Intergenic
1065890805 10:30119476-30119498 CAGATGAAGGAAAAGCAGAGAGG - Intergenic
1066114548 10:32227931-32227953 AAGAAGATGGAAAAGCAGACTGG - Intergenic
1066317148 10:34259387-34259409 CAGTAGCTGGAAAAAAAGCGAGG - Intronic
1066746896 10:38610078-38610100 CAGAAGCTGGAAAACAAGTTAGG + Intergenic
1067149072 10:43714807-43714829 CAGAAGATGGAAGAGCACTTTGG - Intergenic
1068054909 10:51999913-51999935 CAGAATATGGATCAGAAGTTTGG + Intronic
1068200219 10:53774607-53774629 CAGAAGATGGAATAGCTTTGTGG + Intergenic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1068313306 10:55307678-55307700 CAGAAGATGGGTAGGAGGTGTGG - Intronic
1068356242 10:55912973-55912995 CAGAAGATGGAAAGTTAGAGAGG + Intergenic
1068701418 10:60024171-60024193 CAGAATATGGAAGTGCAGTGGGG + Intergenic
1069362973 10:67664611-67664633 AAGAAGAAAGAAAACAAGTGTGG - Intronic
1071083065 10:81836082-81836104 CATCAGATGGAAAAGAAATTGGG + Intergenic
1072165666 10:92810435-92810457 CAGAAGAGGGTCAAGGAGTGTGG - Intergenic
1073076530 10:100828226-100828248 CAGAAGATGGAATGGGGGTGTGG + Exonic
1073867069 10:107817354-107817376 CAAAAGATGGAAAGGCAGTGAGG + Intergenic
1073914545 10:108386999-108387021 CACAGACTGGAAAAGAAGTGTGG + Intergenic
1073918871 10:108436163-108436185 CAGAAGTTGGCAAAGGAGAGAGG - Intergenic
1074452286 10:113568819-113568841 CAGTGGAAGAAAAAGAAGTGCGG + Intronic
1074485065 10:113868285-113868307 CAGAAGAAAGGAAAGAAGAGAGG - Intronic
1074842859 10:117373438-117373460 CAGCAGATGGGAAAGGAGTTGGG - Intronic
1075687063 10:124371568-124371590 GGGAAGATGGAAAAGCAGAGAGG + Intergenic
1076222472 10:128745633-128745655 CAGAAGATGCAAGAGGAGGGAGG + Intergenic
1076233371 10:128841302-128841324 CTGAAGATGAAAAATAAATGAGG - Intergenic
1077519568 11:3024191-3024213 ACAAAGATGGAAAATAAGTGAGG - Intronic
1077694997 11:4385783-4385805 CAGAAGATCGGAGACAAGTGAGG - Exonic
1078917452 11:15793190-15793212 CAGAAGTTGTACCAGAAGTGGGG - Intergenic
1079108402 11:17589040-17589062 CAGGAGGAGGAACAGAAGTGGGG - Intronic
1079413465 11:20210926-20210948 CAGAAGATGGCAGAGCAGTTAGG + Intergenic
1079613703 11:22464757-22464779 CAGTAGGTAGAGAAGAAGTGAGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080494959 11:32808180-32808202 CAGAATAAGGAATAGATGTGTGG + Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1082725491 11:56730252-56730274 CAGAAGATTCAAAACAACTGTGG + Intergenic
1082867577 11:57913772-57913794 CAGAGGATGGTAGAGAACTGAGG - Intergenic
1083354067 11:62052249-62052271 CAGGAGATGGATAAGCCGTGTGG - Intergenic
1083514350 11:63242907-63242929 CAGAAGGTGGAGGAGAAGAGAGG - Intronic
1083777460 11:64901167-64901189 AAAAAAATGAAAAAGAAGTGAGG - Intronic
1083798430 11:65032187-65032209 CAGAGGATGTCAAAGAGGTGAGG + Exonic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084767365 11:71321431-71321453 CAGAAGGTGAAAGGGAAGTGAGG - Intergenic
1085441036 11:76562434-76562456 CAGAAGATGGGAAAGAAGCAGGG + Intergenic
1085911656 11:80834015-80834037 CAGTAAATGGAAAAGATCTGAGG - Intergenic
1086123139 11:83321373-83321395 CAGAGGCTGGAAAGGATGTGTGG - Intergenic
1086666188 11:89486210-89486232 CAGAAGATGAGACAGAAGTCAGG + Intronic
1087585907 11:100121480-100121502 TAGAAGATTGAAAAACAGTGGGG + Intronic
1087789790 11:102393806-102393828 CAGAAGATGGCTAAGAAGAAAGG - Intergenic
1087977616 11:104569244-104569266 CACAAGATGGAAAACCAGAGTGG + Intergenic
1089140467 11:116280180-116280202 CAGGAGATGGCAGGGAAGTGGGG + Intergenic
1089542088 11:119195423-119195445 CAGAAGAAGAAAAAGAACTGGGG - Exonic
1090066923 11:123511140-123511162 CAGAAGGTGAAAAGAAAGTGTGG - Intergenic
1090576675 11:128112597-128112619 CAGATGCTGGAGAAGATGTGGGG + Intergenic
1090779088 11:129990784-129990806 CTGAAAATGAAAAAAAAGTGAGG - Intronic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091612824 12:2025600-2025622 CAGAAGATGGAACAGCATTTTGG - Intronic
1091953519 12:4615709-4615731 CAGAAGAGGGGAAAGCAGTGGGG + Exonic
1092026676 12:5246567-5246589 CAGAAGCTAGAAAAGAGGTCTGG - Intergenic
1092226500 12:6751750-6751772 GAGAGGATGGAAAAAAATTGAGG - Intronic
1092406646 12:8226202-8226224 AAAAAGATGGAAAAGAAGACAGG - Intronic
1092850279 12:12619855-12619877 CACAAGGTAGAAAAGAAGTGTGG - Intronic
1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG + Intergenic
1093185569 12:16015469-16015491 CAGAAGATGAAAAGGAAGCTAGG - Intronic
1093302968 12:17477364-17477386 CTGCAGATTGAATAGAAGTGGGG - Intergenic
1093316471 12:17657327-17657349 TAGAAGATGGAAACCATGTGTGG - Intergenic
1093535120 12:20213750-20213772 CAGAAAATAAAAGAGAAGTGAGG + Intergenic
1093680013 12:21991575-21991597 AGAAAGATGGAAAAGAAGAGGGG - Intergenic
1093863923 12:24201819-24201841 CAAAAGCTGGAAAGGAAGTAAGG - Intergenic
1094001973 12:25705481-25705503 CATTAGTTGGAAATGAAGTGGGG - Intergenic
1094053710 12:26247228-26247250 CAGAAGAGAGAAAAGAGGTAGGG + Intronic
1094459579 12:30680104-30680126 AAGAAGAAGGAAAAGAAGAAGGG - Intronic
1094484332 12:30912266-30912288 CAGGAGAAGGGAATGAAGTGGGG + Intergenic
1095432188 12:42145552-42145574 AAGAAGAGGGAGAAGAACTGGGG - Intergenic
1096726402 12:53566574-53566596 CAGAGGATGGGAAAGAAATAAGG - Intronic
1096898034 12:54844743-54844765 AAGAAGATGTAAAAGATATGTGG - Intronic
1097225803 12:57476255-57476277 CAGAGGAAAGTAAAGAAGTGAGG - Intronic
1097296243 12:57965960-57965982 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1097327461 12:58294383-58294405 AACAAGATGGCAAAGAAGTGGGG - Intergenic
1097763424 12:63494963-63494985 CAGAAGCTGGAAGTTAAGTGGGG - Intergenic
1097785451 12:63753891-63753913 GAGCAGATGGAAAAGAAATTAGG - Intergenic
1097945461 12:65363157-65363179 CAGAAGGTGTCAGAGAAGTGAGG - Intronic
1098442588 12:70534284-70534306 AAGAAAGTGGAAAAGAAGTCAGG + Intronic
1098749222 12:74274027-74274049 TAAGAGATGCAAAAGAAGTGTGG - Intergenic
1098879978 12:75907222-75907244 CAGAAGCTAGAAGAGATGTGTGG - Intergenic
1099125069 12:78744462-78744484 CAAGAGATGGGAAAGAACTGGGG + Intergenic
1100212747 12:92414478-92414500 GAGAAGAAAGAAAAGAAATGAGG + Intergenic
1100735282 12:97522512-97522534 TAGGAGATGGTCAAGAAGTGAGG - Intergenic
1101933321 12:109033767-109033789 CAGAAGCTGGTAAAGAGGTGAGG + Intronic
1102489842 12:113283664-113283686 GAGAAGAAAGAAAAGAAATGAGG - Intronic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102857737 12:116308877-116308899 CAGCAGAGGGAAAAGAAATCAGG - Intergenic
1103652621 12:122444619-122444641 CAGAAAAAGAAAAAGAAATGGGG - Intergenic
1103992824 12:124810554-124810576 CTGAATCTGGAAAAGAAGTGTGG + Intronic
1104150007 12:126073188-126073210 CTGAAGCTGGGAAAGAGGTGTGG - Intergenic
1105532361 13:21231284-21231306 CAGGAGTTGGACAAGCAGTGGGG - Intergenic
1105816567 13:24041657-24041679 CAGAAAGTAGAAAAGAAGGGAGG + Intronic
1105948596 13:25210260-25210282 CTGAAGATGAAAAAGATGAGGGG - Intergenic
1106998718 13:35519920-35519942 CAGAGGATGGGAAGGAGGTGTGG - Intronic
1107377256 13:39817337-39817359 CAGTGGAGGGAAAAAAAGTGTGG - Intergenic
1107403444 13:40091425-40091447 CAAAAGATGGAAAAGATGGTGGG + Intergenic
1107768054 13:43758467-43758489 CAGAGGAGGGACAAGAAGAGAGG + Intronic
1107833343 13:44393684-44393706 CAAAAGAGGGAAAGGAAGCGGGG - Intronic
1107947503 13:45432475-45432497 TAGAAGATGAAAGAGATGTGTGG - Intergenic
1108288914 13:48937938-48937960 CAGAAGCTAGAAGAGAGGTGTGG - Intergenic
1108538070 13:51406736-51406758 TACAAGATGGAAAAGAAGGTTGG - Intronic
1108698615 13:52924988-52925010 GAGAAGATGGAGAGGAAATGTGG - Intergenic
1108976071 13:56444554-56444576 GAAAAGATTGAAAAGAAGTAAGG + Intergenic
1109427949 13:62192781-62192803 CAGAGGCTGGAAAGGATGTGGGG - Intergenic
1110080503 13:71303976-71303998 CACCAGAGGAAAAAGAAGTGGGG - Intergenic
1110133270 13:72033903-72033925 CAAAATATGGAAAAGACATGTGG - Intergenic
1110297589 13:73886457-73886479 CAGAAGATGGAAAAATAGGGGGG + Intronic
1110484396 13:76020852-76020874 TGGAAGATAGAAAAGAAATGAGG + Intergenic
1110537181 13:76665116-76665138 CCGAAGATGGAAATGTAGTGGGG - Intergenic
1111472150 13:88696542-88696564 CAGAAGATGACAGAGAAATGTGG - Intergenic
1111661216 13:91214284-91214306 TAGAGGTTGCAAAAGAAGTGGGG + Intergenic
1112209077 13:97356040-97356062 AAGATGATGGAATACAAGTGGGG + Intronic
1112318158 13:98383271-98383293 CAGAAAATGGCACAGAAATGGGG - Intronic
1112661932 13:101520129-101520151 AAGTAGATGGAAAAGAAGACAGG - Intronic
1113017555 13:105844805-105844827 CACAGGATGGAAAACAAGTTTGG - Intergenic
1113068210 13:106392954-106392976 CAGAAGCTGGAAGAGGGGTGTGG - Intergenic
1114757025 14:25270739-25270761 CAGATTATGTAAAATAAGTGAGG - Intergenic
1114823386 14:26048831-26048853 CACAAAAGGGAAAAGAAGAGAGG + Intergenic
1115111417 14:29827940-29827962 AAGCAGGTGGAAAAGAAATGAGG - Intronic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1117373354 14:55098842-55098864 CAGAAGAAAGGAAAGAAGTATGG + Intergenic
1117448709 14:55829785-55829807 CTGAGGATGGATAAGAGGTGAGG + Intergenic
1117479234 14:56126625-56126647 CACAAGATGGGAAAGGAGGGGGG - Intronic
1118186373 14:63542546-63542568 CAGAAGGTGGAGAAAAAGGGGGG + Intronic
1118879611 14:69815262-69815284 CAGGAGATGGACAAGCCGTGTGG + Intergenic
1119074339 14:71621024-71621046 GAGAAGATGGGAATAAAGTGTGG - Intronic
1119335523 14:73830391-73830413 AAGAAGAAGGAGAAGAAATGAGG - Intergenic
1119465546 14:74855322-74855344 CACAAGAAAGAAAAGACGTGAGG + Intronic
1119628799 14:76208045-76208067 TTCAAGATGGAAAAGAAGTGTGG - Exonic
1119714001 14:76845338-76845360 AAGAAGAAGGAAAAGAAGAAGGG + Intronic
1119928293 14:78518468-78518490 CATAAAATAGAAAAAAAGTGAGG + Intronic
1120146958 14:80989176-80989198 AAGTGGAGGGAAAAGAAGTGTGG - Intronic
1120290722 14:82567018-82567040 AAGAGGATGGAAAAAAACTGTGG - Intergenic
1120448466 14:84633254-84633276 CAGAAGCTAGAAACAAAGTGAGG + Intergenic
1120496147 14:85238787-85238809 CAGAAAAGGTAAAAGAAGTGTGG + Intergenic
1120916276 14:89713295-89713317 CAGAAGCTAGGAAAGAGGTGTGG - Intergenic
1121701954 14:95961412-95961434 CAGAAGCTGGAAGAGGAATGGGG + Intergenic
1121944360 14:98104887-98104909 CAGAAACTGGAAAAGATGAGAGG - Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122655989 14:103259544-103259566 CAGGACATGGAATAGAAGTACGG - Intergenic
1122730454 14:103793180-103793202 AAGAAAAGGGAAGAGAAGTGAGG + Intronic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1122948566 14:105027059-105027081 CAGAAGAGAGAAAGGAAGGGAGG + Intergenic
1123196650 14:106623451-106623473 CAGAAGACGTAAGAGAAGTTTGG + Intergenic
1124361057 15:29036646-29036668 GAGATGATGTAAAAGAGGTGTGG - Intronic
1124498604 15:30206498-30206520 CCCAAAATGGATAAGAAGTGTGG - Intergenic
1124744977 15:32332178-32332200 CCCAAAATGGATAAGAAGTGTGG + Intergenic
1124839720 15:33230384-33230406 CAGTAGATGACCAAGAAGTGTGG + Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125117976 15:36118139-36118161 CAGAAAATAGAAAAGAAGTAAGG - Intergenic
1125512256 15:40298387-40298409 CAGAGGATGGGGAAGAGGTGAGG + Intronic
1126383528 15:48071558-48071580 CAGATGATAGAAATCAAGTGAGG + Intergenic
1126421343 15:48476465-48476487 CAGAAGAAGACAAAGAAGTTGGG + Intronic
1126447947 15:48771033-48771055 AAGAAGAGGGAAAAGGAATGTGG - Intronic
1127402879 15:58608295-58608317 AAGAAGCTGTGAAAGAAGTGAGG - Intronic
1127841397 15:62835276-62835298 CAGATGATGTTAAAAAAGTGTGG - Intronic
1127877443 15:63122673-63122695 CTGTAGATGGAAAAGAAGTCTGG + Exonic
1128266978 15:66275348-66275370 CAGAAGATTTAAAAAAATTGTGG - Intergenic
1128743808 15:70100084-70100106 AAGAAGAAGGAAAAGAAAAGAGG + Intergenic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129706547 15:77797809-77797831 CAGAAGATGGAAAAGCCCTCAGG + Intronic
1130100681 15:80891524-80891546 CAGAAGATTCAACAGCAGTGTGG + Intronic
1130611597 15:85366283-85366305 TAGAAGCTGGAAAAGCTGTGAGG + Intergenic
1130791805 15:87163160-87163182 GAGAAAATGGAAAAGAAAAGGGG - Intergenic
1130981326 15:88813672-88813694 CAAAAGATGTAAAGGAAATGAGG - Intronic
1131228473 15:90643977-90643999 CAGAAGATAGAAATGGAATGAGG - Intronic
1131329541 15:91484407-91484429 TAGAAGATGGCATAGCAGTGAGG - Intergenic
1131606907 15:93915178-93915200 CAGAAGATAGAAATTAAGTGTGG + Intergenic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133830081 16:9314895-9314917 CAGATGAAGGAACTGAAGTGTGG + Intergenic
1134372310 16:13636892-13636914 CAGAGGAGGGAAAAGAAGCAAGG + Intergenic
1134414817 16:14034269-14034291 CAGAAGCTGGAAGAGAGGTGGGG - Intergenic
1135268786 16:21051328-21051350 CATAAGATAGACAAGAAGTGAGG - Intronic
1135637691 16:24093098-24093120 TTGCAGATGGAAAAGAAGGGAGG - Intronic
1135710883 16:24716196-24716218 CAAGAGATGGGAAAGAAATGAGG - Intergenic
1136043779 16:27600179-27600201 AAGAAGGTAGGAAAGAAGTGGGG + Intronic
1136502222 16:30677655-30677677 CAGAGCAGGGAAATGAAGTGAGG - Intergenic
1136736166 16:32469564-32469586 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
1137372351 16:47919312-47919334 CAGGAGGTGAAAGAGAAGTGAGG - Intergenic
1137468231 16:48730626-48730648 CAAAAGGTGCAAAAGAACTGTGG - Intergenic
1137703028 16:50511078-50511100 CAGAAGATTGAATAGAATAGTGG - Intergenic
1138218690 16:55229379-55229401 CAGAAAATGGGAAAGAAATATGG + Intergenic
1138248423 16:55484170-55484192 CAGAAGATGGGGCAGAAGAGGGG + Intronic
1138652308 16:58467711-58467733 CAGATGAGGAAAATGAAGTGTGG - Intronic
1138746222 16:59366040-59366062 CAGTAGTTGGAACACAAGTGTGG + Intergenic
1139207030 16:65038896-65038918 CAGGTGAGAGAAAAGAAGTGAGG + Intronic
1139232192 16:65294432-65294454 CAGAAAACGGAAAAGGAGAGTGG + Intergenic
1139777317 16:69324569-69324591 CAAAAGATGGAAAAAAAAGGGGG - Exonic
1140136407 16:72209842-72209864 CAGAAGATGGAAAGGCAGCAGGG + Intergenic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1140806028 16:78533083-78533105 CTGAGGATGGAAAGGAACTGAGG - Intronic
1140996205 16:80261971-80261993 AAGAAGAGTGAAAAGAAATGAGG - Intergenic
1141487967 16:84353746-84353768 CAAAAGAAAGAAAAGAAATGAGG + Intergenic
1142341102 16:89523071-89523093 CAGAGGATGGAAAAGACATTCGG - Intronic
1203016906 16_KI270728v1_random:360010-360032 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1203035241 16_KI270728v1_random:633168-633190 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1142498233 17:317693-317715 CAAAAGCAGGAAAAGAAATGAGG + Intronic
1142641984 17:1289566-1289588 CACAAGATGGGAAAGAAGGAGGG - Intronic
1143891287 17:10104409-10104431 GAGTAGATAGAAAAGAGGTGGGG - Intronic
1143949266 17:10619880-10619902 AAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1144751338 17:17650546-17650568 CAGAAAATGGAGCGGAAGTGGGG + Intergenic
1146597348 17:34181743-34181765 AAGGAGATGAAAAAGAAGTCGGG + Intergenic
1146874751 17:36399912-36399934 CAGATGCTGGAAAGGATGTGGGG - Intronic
1146902316 17:36596801-36596823 CAGCAGATGGGAAAGGATTGTGG - Intronic
1147699253 17:42381955-42381977 CAGAAAAGGGATAAGAACTGTGG + Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148250777 17:46077916-46077938 AAAAAGATGGAAAAAAATTGAGG - Intronic
1148261004 17:46183539-46183561 CAAAAGAAGGAAAAGAGGAGAGG + Intronic
1148546559 17:48523725-48523747 TAGAAGATGGATAAGAAGTCTGG - Intergenic
1148661626 17:49338441-49338463 CAGAAGGGCGAAAAGAAGAGGGG + Intronic
1149008661 17:51832153-51832175 CAGATGAAGAAAGAGAAGTGAGG - Intronic
1149110655 17:53025416-53025438 CAGAAGAAAGAGAAGAAATGGGG - Intergenic
1149184506 17:53981401-53981423 CTGAAGATGGAATTGAATTGAGG - Intergenic
1149242266 17:54663773-54663795 CAGAGGGAGGAAAAGCAGTGTGG - Intergenic
1149273178 17:55004777-55004799 AAGGAGAAGGAAAAGAAGTGGGG + Intronic
1149886531 17:60345623-60345645 CAGAAGATGGGTAAGAAATCAGG + Intronic
1150655374 17:67035797-67035819 TAGGAGATGGAAATGATGTGTGG - Intergenic
1151100280 17:71548852-71548874 GAGAAGAGAGGAAAGAAGTGGGG - Intergenic
1151413229 17:73944845-73944867 TAGAGGAAGAAAAAGAAGTGGGG - Intergenic
1151557782 17:74855198-74855220 CGGAAGATGAAAGAGAAGAGGGG + Intronic
1153060601 18:991047-991069 CAGAAGCTAGGATAGAAGTGTGG - Intergenic
1153167086 18:2274276-2274298 AAGAATATGGAGTAGAAGTGTGG + Intergenic
1153171517 18:2321222-2321244 AAGATGATGGGAAAAAAGTGAGG + Intergenic
1153511038 18:5852852-5852874 CACAAGATGGAAATAAAATGGGG + Intergenic
1153899543 18:9604523-9604545 CATAAGACAGAAAAGTAGTGGGG - Intronic
1153939449 18:9965546-9965568 CAAAAAATGGAAAAGAAGAAAGG - Intergenic
1154025831 18:10706317-10706339 CAAAGGATGGAAAAGCAGGGTGG - Intronic
1155086256 18:22461581-22461603 CAGAAGATGAGAAAAAAGTGAGG + Intergenic
1156735241 18:40249485-40249507 CATATGCTGAAAAAGAAGTGTGG + Intergenic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157297358 18:46456059-46456081 TGGAAGATGGAGAAGATGTGAGG + Exonic
1157427368 18:47595350-47595372 CAGCAGGTGGAAAAGAATGGGGG + Intergenic
1157479275 18:48042728-48042750 GAGAAGGTGGGAAAGCAGTGAGG - Intronic
1157533135 18:48439110-48439132 AAGAAGATGGAAGAGATGTATGG - Intergenic
1157903199 18:51540900-51540922 CAGAAGAGAGAAATGAAATGAGG - Intergenic
1157972845 18:52290133-52290155 CAGAAAATGTAAAAACAGTGAGG + Intergenic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161994552 19:7704283-7704305 ACCAAGATGGTAAAGAAGTGAGG - Intergenic
1162914928 19:13869511-13869533 CCGCAGCTGGAAAGGAAGTGGGG + Intronic
1163261334 19:16191969-16191991 CAGAAGAGAAAAACGAAGTGTGG + Exonic
1163872009 19:19830097-19830119 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
1163886274 19:19967317-19967339 GAGAGGAAGGAAAAGCAGTGTGG - Intergenic
1163888193 19:19988167-19988189 GAGAAGAAGGAAAAGCAATGTGG + Intergenic
1164793718 19:31009276-31009298 CAGAAGAGGAAATAGGAGTGTGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1166528927 19:43530773-43530795 CAGAGGAGGAAAATGAAGTGTGG - Intronic
1166578908 19:43874612-43874634 CAGGAGATGGGAAAGATTTGTGG - Intronic
1167198533 19:48047732-48047754 AAGAAGATGGAAAGGAAAGGGGG + Intergenic
1168010540 19:53527515-53527537 CAGAAGAAGAGAAAGAGGTGAGG + Intronic
1168092922 19:54097210-54097232 CAGAAGATGAAAGGGAAGTTGGG + Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
925832651 2:7911163-7911185 AGGAAGAAGGAAAGGAAGTGTGG - Intergenic
928121697 2:28588363-28588385 CAGAAGAGGGGAAGGAAGTGAGG - Intronic
928605870 2:32945015-32945037 CATAAGATGACAAAGAATTGTGG + Intergenic
928783215 2:34849848-34849870 CAGAAGCTGGAAAAGACCAGGGG + Intergenic
929046675 2:37797329-37797351 CTGAAGATGGAAACTGAGTGAGG - Intergenic
929792066 2:45030761-45030783 AAGGAGATGGAGAAGAAGAGAGG - Intergenic
932575350 2:72959629-72959651 CAGTAGGTGGAAGAGGAGTGGGG - Intronic
932882434 2:75516356-75516378 AAGGAAATGGAAAAGCAGTGTGG - Intronic
933129391 2:78654683-78654705 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
933407806 2:81883798-81883820 CAGAAGAATGAAAATAACTGAGG + Intergenic
933450629 2:82445686-82445708 CAAGAGATGGGAAAGAACTGAGG + Intergenic
933634510 2:84693113-84693135 GAGAAGAAGGAATAGAACTGAGG - Intronic
934126292 2:88894825-88894847 CAAAAGACAGAAAAAAAGTGTGG - Intergenic
934187332 2:89758678-89758700 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
934309302 2:91849260-91849282 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
935102999 2:100014659-100014681 AAGGAGATGGAAAAGAAGAAGGG + Intronic
935394647 2:102594036-102594058 CCAAAGATGGCAATGAAGTGAGG - Intergenic
935473213 2:103484686-103484708 AACAAGATGAAAAAGATGTGAGG - Intergenic
935605454 2:104968651-104968673 TAGAAAATGGAAAAGAAAGGTGG + Intergenic
936324097 2:111490154-111490176 CAGAAGAGAGGAAGGAAGTGGGG - Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
937080210 2:119135258-119135280 CAGAATCTGGAAAGGAAGTAGGG - Intergenic
937281822 2:120722562-120722584 CAGAAGATGGAATAAATGTCTGG - Intergenic
937349224 2:121149919-121149941 CAGAAGATGAGCAAGAGGTGTGG + Intergenic
937617230 2:123940454-123940476 CAGATCATGGAGAAGAAATGAGG - Intergenic
937642958 2:124234685-124234707 CAGAAGTTATAAAAGAAGTGAGG - Intronic
938141489 2:128798319-128798341 CAGAAGCTGGAAAAGAACCCAGG - Intergenic
938790965 2:134675642-134675664 AAGAAGATGAATAAGAAGTAAGG + Intronic
939198409 2:139002638-139002660 CAGAAGATGGGAAAGCAAGGAGG + Intergenic
939611759 2:144319657-144319679 AAGGAGTTGAAAAAGAAGTGTGG - Intronic
939781098 2:146449096-146449118 CAGAAGGTAGAAAAGAAGGTTGG - Intergenic
939958635 2:148547217-148547239 CACAAGATGGAAAAGAACCCAGG - Intergenic
940015643 2:149101369-149101391 CAGAAAATAGAAAGGAATTGGGG + Intronic
940647353 2:156405533-156405555 CAGAATTAGCAAAAGAAGTGGGG - Intergenic
941745577 2:169083298-169083320 GAGAGGAAGGAAAAGAGGTGTGG - Intronic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
942692255 2:178598512-178598534 AAGAAGAAGGAAAAGAAGAATGG - Exonic
942787477 2:179716379-179716401 CAGAAAATGGAAAATAGGTCAGG - Intronic
942887606 2:180946390-180946412 CACAATATTGAATAGAAGTGGGG + Intergenic
943508378 2:188792429-188792451 CAGAATAGGACAAAGAAGTGTGG - Intergenic
943888783 2:193258289-193258311 AAGAAAAGGGAATAGAAGTGTGG + Intergenic
944062089 2:195580706-195580728 AAGAAGAAAGAAAGGAAGTGTGG + Intronic
944355642 2:198784462-198784484 CAGATGCTGGAGAAGATGTGGGG - Intergenic
944959832 2:204859402-204859424 TAAAAGATGTAAAAGAAATGTGG + Intronic
945557374 2:211296080-211296102 AGGATGATGTAAAAGAAGTGGGG + Intergenic
946167322 2:217872540-217872562 CAAAAGATAGAAAATAAATGTGG + Intronic
947414529 2:229880172-229880194 TACAATATGGAAAAGAAATGAGG + Intronic
948105538 2:235410940-235410962 CAGAAGAAGGGAGAGAACTGGGG + Intergenic
948431902 2:237923917-237923939 CAAAAGATAGAAAAAAAGGGAGG - Intergenic
948747242 2:240105742-240105764 CAGCAGATGGGAAAGGGGTGAGG + Intergenic
948863278 2:240763160-240763182 CAGGAGATGGAGCAGAGGTGAGG - Exonic
1169135116 20:3192519-3192541 AAGAGGATGGATAAAAAGTGTGG - Intronic
1169425611 20:5494997-5495019 CAGAAGAGGGCAGAGAAGGGAGG + Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170654496 20:18273403-18273425 CAGAAAATTGAAAAGAGGTGAGG + Intergenic
1170972471 20:21128867-21128889 CTGAAGATGGTATAGAATTGTGG + Intronic
1171210375 20:23311713-23311735 CAGAAGATGATAAAGAAATTTGG - Intergenic
1171333851 20:24365376-24365398 CAGAAGGTGGAGGACAAGTGAGG + Intergenic
1172219133 20:33260617-33260639 GAGGAGATGGATATGAAGTGAGG + Intergenic
1172427768 20:34867226-34867248 TAGAAGTTTCAAAAGAAGTGTGG + Intronic
1172802978 20:37591302-37591324 CAGAAGATGTACAGGAACTGGGG - Intergenic
1173079008 20:39848377-39848399 CTGAAGATAGAACAGAAGTCGGG + Intergenic
1174706371 20:52660385-52660407 GGGAAGATTGTAAAGAAGTGAGG + Intergenic
1174942605 20:54947155-54947177 TTGAAGATAGAAAAAAAGTGAGG - Intergenic
1175303083 20:57956805-57956827 GAGAAGCTGGAAAGGCAGTGAGG - Intergenic
1175536169 20:59715472-59715494 CAAAACATGGAAAACAAGTTAGG - Intronic
1176672213 21:9745195-9745217 GGGAGGAGGGAAAAGAAGTGGGG + Intergenic
1177483968 21:21731174-21731196 AAGAAGATGGAAAATAAGAAGGG + Intergenic
1178612353 21:34095455-34095477 CAGAAGTTGTAAAAGCAGTAAGG - Exonic
1179396592 21:41045833-41045855 CAGCAGGTGGGAGAGAAGTGTGG - Intergenic
1179921973 21:44512363-44512385 CCTAAGATGGGAAAGAAGGGTGG + Intronic
1180536385 22:16396370-16396392 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1180819001 22:18812452-18812474 GTGAGGATGGGAAAGAAGTGGGG - Intergenic
1181205225 22:21246900-21246922 GTGAGGATGGGAAAGAAGTGGGG - Intergenic
1181494423 22:23280006-23280028 CATAAGAAGGAAAAAAAGAGAGG - Intronic
1182344027 22:29647237-29647259 CAGAAGAGAGAAAAGAATTGTGG + Intronic
1183526501 22:38326212-38326234 CTGAAGATGGAAGAGGAGGGAGG - Intronic
1183917585 22:41134855-41134877 CAGAAGATATAAAACAAGAGGGG - Intronic
1184168236 22:42743291-42743313 CAGGAGATTGAAAAGCTGTGAGG + Intergenic
1184365572 22:44049007-44049029 CCGAGGAGGGAACAGAAGTGTGG + Intronic
1203221700 22_KI270731v1_random:48515-48537 GTGAGGATGGGAAAGAAGTGGGG + Intergenic
1203269126 22_KI270734v1_random:38305-38327 GTGAGGATGGGAAAGAAGTGGGG - Intergenic
949130089 3:489390-489412 GTGAAGATGGAAAAGAACAGAGG + Intergenic
949171274 3:1000250-1000272 CAGTAGCTGGGAAAGAAGTATGG + Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949565905 3:5244628-5244650 CAGATGCTGGAGAAGATGTGGGG + Intergenic
949645258 3:6086007-6086029 CAGAAATTGGAAAAGAAGCTGGG - Intergenic
950115142 3:10445902-10445924 CAGAAGATGGCCAAGCAGGGTGG + Intronic
950696459 3:14704499-14704521 CAGAAGATGGGTGAGAGGTGGGG - Exonic
950962083 3:17117962-17117984 CAGGAGATGGGAAAGAACAGAGG + Intergenic
951403794 3:22269045-22269067 AAGAAGCTGGAAAATATGTGGGG - Intronic
951614298 3:24524264-24524286 AAGGAGCTGGAAAAGAAGAGTGG + Intergenic
951768061 3:26222568-26222590 CAGAAGAAGGCAAATAACTGTGG - Intergenic
952137621 3:30441050-30441072 CAGGAGTTGGAACAGCAGTGTGG + Intergenic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952503890 3:33989735-33989757 GAGAAGAAGGAAGAGCAGTGTGG - Intergenic
952518086 3:34125903-34125925 CAGATGGTGGAAAAGAAAGGCGG - Intergenic
952593531 3:34987850-34987872 CAGAAGCTGGGAAAGATGTGTGG + Intergenic
952628316 3:35434675-35434697 CAGAAGGTAGAAAATCAGTGAGG - Intergenic
952955179 3:38552459-38552481 CAGAAGAGGAAACAGAGGTGAGG + Intronic
953041081 3:39255466-39255488 CTGAAGAGGGAAGAGAAGTGAGG + Intergenic
953115717 3:39990269-39990291 GAGAAGAAGGAAGAGTAGTGTGG - Intronic
953685348 3:45073877-45073899 GGGAAGATGGATATGAAGTGTGG + Intergenic
953767564 3:45755327-45755349 GAAAAAATGGAAAATAAGTGGGG - Intergenic
953803605 3:46048604-46048626 CAGGAGATGGACAAGCCGTGTGG - Intergenic
953846399 3:46430472-46430494 CAGGAGATGGACAAGCCGTGTGG + Intergenic
953996143 3:47521520-47521542 CAGCACCTGGAAGAGAAGTGGGG - Intergenic
954365316 3:50142953-50142975 AAGAAAAAGAAAAAGAAGTGTGG - Intergenic
954888229 3:53896670-53896692 CAGAAGATGGAAATTCAGAGAGG - Intergenic
955036900 3:55276694-55276716 CAGAAGAGGGAAAGAAAGAGGGG + Intergenic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955193731 3:56785650-56785672 CAGAAGAGGAAAAAGAAGTAGGG + Intronic
955216226 3:56986755-56986777 CAGTAGGTAGGAAAGAAGTGGGG + Intronic
955307465 3:57848608-57848630 AAGAAGAAGAAAAAGAAGAGGGG - Intronic
955308357 3:57858263-57858285 CAAAAGATTTAAAAGAATTGTGG - Intronic
955819316 3:62879271-62879293 AAGAAGATGAAAAAGAAAAGTGG + Intergenic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956195186 3:66647371-66647393 AATGAGATGGAAAAGAAGGGAGG + Intergenic
956718144 3:72096311-72096333 CAGAGGATGGAAAAGATATGTGG - Intergenic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
958841544 3:99210784-99210806 CAGAAGATGAGAAAGATGAGAGG - Intergenic
959444384 3:106420469-106420491 GAGAAGGAAGAAAAGAAGTGAGG + Intergenic
960095487 3:113685909-113685931 CAGAAGAGGGAAAAGTAAAGAGG - Intronic
960880015 3:122334664-122334686 CAAAAGACAGAAAAGAATTGGGG + Intronic
961407100 3:126687361-126687383 GAAAAGATGGAAAGGGAGTGAGG - Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
962147973 3:132861156-132861178 CAGATGATGGAATAGAGATGGGG - Intergenic
962945436 3:140164964-140164986 AAGAAAATAGGAAAGAAGTGAGG + Intronic
963341067 3:144034437-144034459 CAGAACTTGGGAAGGAAGTGTGG + Intronic
963382182 3:144544835-144544857 CAGAAGAGGGAATAAACGTGGGG + Intergenic
963433298 3:145236468-145236490 CAGAAGGTAGAAAAGCATTGAGG - Intergenic
963500406 3:146118682-146118704 AAGAAGATGGCAAAAAAGAGTGG + Intronic
964471729 3:157064062-157064084 CTCCAGATGAAAAAGAAGTGGGG - Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964570838 3:158106070-158106092 AAGAAGAAGGAAAAAAAGAGCGG - Exonic
964784461 3:160379922-160379944 CTGAAGATGGAAAGGATGTTAGG - Intronic
964809023 3:160642241-160642263 GAGAAGATGGGAAAGCACTGAGG + Intergenic
965213369 3:165826006-165826028 CTGAAGATGTGAAACAAGTGGGG + Intronic
965253905 3:166379271-166379293 CAGATGATGGAGAGGATGTGGGG + Intergenic
965417111 3:168409868-168409890 CAGAAAATGGTAAATAAATGAGG - Intergenic
965816283 3:172640216-172640238 AAAAAGCTGGAAAAGGAGTGAGG - Intronic
965821272 3:172686750-172686772 GAGAAAATGCAAAGGAAGTGCGG - Intronic
965845733 3:172959180-172959202 CAGCAGTTGGAAAAGAAATGGGG - Intronic
965980596 3:174685446-174685468 CAGAAAATGGAAGAGAAGTTTGG - Intronic
966297469 3:178440841-178440863 CAGAACAAGACAAAGAAGTGTGG - Intronic
966331921 3:178824153-178824175 GAGAAGGTAGAAAAGAAATGCGG - Intronic
966425765 3:179778248-179778270 AAGAAGATACAAAACAAGTGAGG + Intronic
966539726 3:181075618-181075640 GAGAGGAAGGAAGAGAAGTGTGG - Intergenic
967093431 3:186154712-186154734 CAGAGGGTGGGGAAGAAGTGTGG + Intronic
967731385 3:192910097-192910119 CAGAAGATGGCAAATAAGGTAGG + Intronic
967830364 3:193913325-193913347 CAGCAGATGCAAAATATGTGAGG + Intergenic
968330448 3:197864686-197864708 AAGAAGAAGAAAAAGAAATGAGG - Intronic
968334899 3:197905074-197905096 CAGAAGCTGGGAAGGTAGTGGGG + Intronic
969355284 4:6621348-6621370 CAGGACAGGGAAAAGCAGTGCGG + Exonic
969759490 4:9171781-9171803 AAAAAGATGGAAAAGAAGACAGG + Intronic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
971682016 4:29712186-29712208 CAGAAGCTGGAAAGGTTGTGTGG - Intergenic
971945749 4:33274516-33274538 CAGAAGGTGAAAAAGAAATAAGG + Intergenic
972852192 4:43064007-43064029 AAGAAGACCGAAGAGAAGTGAGG + Intergenic
973839419 4:54845591-54845613 CAGATGGTGGAAAAGTTGTGAGG + Intergenic
974294748 4:59982650-59982672 CATAAGAAAGAATAGAAGTGAGG + Intergenic
974306625 4:60151058-60151080 CAGATGCTGGAGAAGATGTGAGG - Intergenic
974390008 4:61254213-61254235 TAGAAGATGGAAGTGAATTGGGG - Intronic
974531217 4:63110268-63110290 CAGAAGAAAGAAAGGAAGCGAGG + Intergenic
974629759 4:64471440-64471462 AAGAAGATGGAAAAAAAATAAGG + Intergenic
976319103 4:83691231-83691253 AGGAAGGTGGAAATGAAGTGGGG - Intergenic
976718494 4:88148289-88148311 CTGTAGATGGAAAAGAAGAAAGG + Intronic
976827557 4:89277613-89277635 CAGAGGATGAAAAAGGAGTTTGG - Intronic
977237699 4:94528275-94528297 CAGAAGGGGAAAAAGGAGTGAGG - Intronic
977395546 4:96466789-96466811 CAGAATATGGATAAGAAATTAGG - Intergenic
977477795 4:97535825-97535847 CCTCAGATGGAAAAGCAGTGGGG - Intronic
977963490 4:103114789-103114811 CAGAAGCTTTAAAAGAACTGGGG - Intronic
978308786 4:107363063-107363085 CAGAATATGGAAACCAAATGAGG - Intergenic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979461796 4:120992232-120992254 CAGACGATGAGTAAGAAGTGTGG - Intergenic
980184551 4:129445961-129445983 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
980858354 4:138468146-138468168 AAGAATATGGAATAGAAGGGTGG + Intergenic
980873901 4:138641201-138641223 CAGAATATGGAAAAGAATAATGG - Intergenic
982034658 4:151333884-151333906 CAGAAGCTGGAAGAGAAGCCTGG - Intergenic
982155133 4:152512298-152512320 AACAAGATGGAAAATAAGAGTGG + Intronic
982430492 4:155316342-155316364 CAGTAGATGGAAAAAATGTGTGG - Intergenic
982566161 4:156989506-156989528 TAGAACATGGAATAGAAGTGAGG + Intergenic
983178659 4:164622166-164622188 CACTAGATGGAACAGAAGAGTGG + Intergenic
983371855 4:166870050-166870072 TGGAAGAAGGAAAGGAAGTGTGG + Intronic
984124791 4:175794720-175794742 AAGAAGATGGAAAATAAATCAGG + Intronic
984579859 4:181499678-181499700 CAGATGATGGAAAGGAAGCTGGG + Intergenic
984613250 4:181865560-181865582 CAGAGGATGGCAAAGAGGAGGGG + Intergenic
985185392 4:187309203-187309225 CAGTAGGTTGAAAAGAAGTATGG + Intergenic
985402520 4:189606653-189606675 GGGAGGAGGGAAAAGAAGTGGGG - Intergenic
985927512 5:3029478-3029500 CAGAAGAAGCAGAAGATGTGGGG + Intergenic
986270162 5:6223141-6223163 TAAAAGATGGAGGAGAAGTGAGG - Intergenic
986458804 5:7947881-7947903 CAAAAGATGGAAAATATTTGTGG + Intergenic
986467489 5:8040685-8040707 CAAAACATGGGAAAAAAGTGGGG - Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986780526 5:11061274-11061296 GATAAGATGGAAGAGCAGTGAGG - Intronic
986900804 5:12431001-12431023 CAGCAGATGTAAAAAAAGCGAGG + Intergenic
986925937 5:12750584-12750606 AAGACAATGGAAAAGAAATGTGG - Intergenic
987482716 5:18478568-18478590 CAGAACTTGGATAAGATGTGAGG + Intergenic
987593130 5:19958933-19958955 CAGAAGATGGTATGGCAGTGAGG - Intronic
987660877 5:20873906-20873928 CAGAAAATGGAAAAGAGCAGAGG + Intergenic
989661224 5:43799891-43799913 CAGAAGGTGGAAGCAAAGTGAGG + Intergenic
990540109 5:56764124-56764146 CAGGAAATGGAGAAGAAATGTGG - Intergenic
990663769 5:58048971-58048993 GAGAAGAAGGAACTGAAGTGGGG + Intergenic
990972987 5:61529988-61530010 GAGATGAAGGGAAAGAAGTGGGG - Intronic
991487292 5:67150684-67150706 CATCAGAAGGTAAAGAAGTGGGG + Intronic
991661764 5:68957883-68957905 CAAAAGCTGGCAAAGAAATGAGG + Intergenic
991990225 5:72330867-72330889 GAGAACAAGGGAAAGAAGTGGGG - Intronic
993396357 5:87394484-87394506 CCTAAGAAGGAAAAAAAGTGTGG + Exonic
993423078 5:87726415-87726437 CAGAAAGTGGAATAGAAATGTGG + Intergenic
994374094 5:98998359-98998381 CAGAAGATACAAAAGAAGAGTGG - Intergenic
994439370 5:99783314-99783336 AAAAAGCTGGAAAAGAAGGGAGG - Intergenic
994798119 5:104332706-104332728 AAGAAGATGGAAATAAAGAGTGG - Intergenic
995851935 5:116555284-116555306 GAGGAGATAGAAAAGAAGTTGGG - Intronic
996540007 5:124620760-124620782 TAGAAGATAGAAAACAGGTGAGG + Intergenic
997193606 5:131962785-131962807 CAACAGATGGAAAAGAAATCGGG - Intronic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
997754697 5:136385293-136385315 GAGAAGATGGATATGAAATGGGG - Intronic
998227518 5:140338529-140338551 CAGAAGATAGAAATAAAGTTTGG + Intronic
998655763 5:144177515-144177537 CAGAAGCTGCAAAAGAGGTACGG - Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999002010 5:147934390-147934412 CTGAAGGTGGGAAAGAATTGAGG + Intergenic
999676776 5:154012069-154012091 TAGAAGGCGGAAAAGAAGAGAGG + Intronic
999928317 5:156403783-156403805 GAGAAGATAGAAAAGAACTTGGG + Intronic
1000435510 5:161202884-161202906 GAGAAGATGGATATAAAGTGGGG + Intergenic
1000513493 5:162211783-162211805 CTGAAGATGGTAAAGAAATTAGG + Intergenic
1000614348 5:163411210-163411232 CAGAGGACGGAGAAGCAGTGTGG + Intergenic
1000699739 5:164433888-164433910 CAGTTGCTGGAAAAGGAGTGCGG + Intergenic
1001868225 5:175124511-175124533 TTGGAGATGGAAAAGAACTGAGG - Intergenic
1002717830 5:181239586-181239608 CAGAAGATGGAAAGGAAATTAGG + Intronic
1002791390 6:440502-440524 GAGAAGATGGAAGAGAATGGTGG - Intergenic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1003751115 6:9057103-9057125 CAGAAGAAGGAAGGGAAGTGGGG - Intergenic
1004032895 6:11888901-11888923 AAGAAGGTGGAAAAGAGCTGAGG + Intergenic
1004056554 6:12144871-12144893 CAGATGATGGAGAGGATGTGGGG + Intronic
1004455860 6:15790877-15790899 GAGAAAATGGGAAGGAAGTGAGG + Intergenic
1005500932 6:26428589-26428611 CAGAAGAACTAAAAGAAGTCGGG - Intergenic
1005505506 6:26465897-26465919 CAGAAGAACTAAAAGAAGTTGGG - Intronic
1006242373 6:32695561-32695583 CAGAGGTTGGAAAGGTAGTGGGG + Intergenic
1006450526 6:34103370-34103392 CAGAAGCTGGAGAAGAATAGTGG + Intronic
1006755850 6:36414699-36414721 CACAACATGGAAAAAAAATGAGG + Intronic
1006799399 6:36750419-36750441 CAGAAGAGGAGAAAGAGGTGGGG - Intronic
1007131811 6:39482346-39482368 CAGATGATGGAAGAGCTGTGAGG + Intronic
1007771968 6:44199498-44199520 CTGAAGAAGAAAAAGAAGAGGGG - Intergenic
1008328510 6:50216772-50216794 CAGAAGAAGTTAAAGAACTGGGG + Intergenic
1008849030 6:56001850-56001872 AGGAAAATGGAAAAGAAGAGAGG + Intergenic
1009349242 6:62653333-62653355 CATAAGAGGGAAAGGAATTGGGG + Intergenic
1009402334 6:63271589-63271611 TTGAAGAAGGAAAAGAAATGTGG - Intergenic
1010504526 6:76641006-76641028 CAGGAGCTGGAACAGAAGAGAGG + Intergenic
1010708766 6:79146872-79146894 ATGAAGATGGAAAAGGAGAGTGG + Intergenic
1010928066 6:81767643-81767665 CAGGAGGTGGAGAAGAAATGTGG + Intergenic
1011836801 6:91441352-91441374 CAGGAGAAAGATAAGAAGTGAGG + Intergenic
1011837815 6:91456002-91456024 CAGTAGATGGAAAATTACTGAGG + Intergenic
1012278953 6:97305821-97305843 GAGGAGCTGGAAAAGAAGGGGGG + Intergenic
1012411205 6:98959584-98959606 AAGAACATGGAATAGAAGTGTGG - Intergenic
1012523530 6:100149858-100149880 AGGAAGATGGGAAAGAAGGGAGG - Intergenic
1013196655 6:107850118-107850140 TAGTAGCTGGAAGAGAAGTGGGG - Intergenic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013676823 6:112473677-112473699 CAGAAGATGGTCAATAAATGTGG - Intergenic
1013697858 6:112725179-112725201 CAGAATATGCAAAGGAACTGTGG - Intergenic
1014453745 6:121613321-121613343 CAGTAGAATGAAAAGAAGGGTGG + Intergenic
1014682807 6:124453502-124453524 TAGAGGATGAAAAAAAAGTGAGG + Intronic
1014693595 6:124591735-124591757 CAGAATATGTGAAAGAACTGTGG - Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015457220 6:133439998-133440020 GAGAAGAAAGAAAATAAGTGAGG - Intronic
1016429526 6:143968060-143968082 CTGCAGCTGCAAAAGAAGTGAGG + Intronic
1016878334 6:148885651-148885673 CAGAAGATGACAAAGAAAAGGGG + Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017373186 6:153736563-153736585 CAGAATATGGAGATGAAATGGGG - Intergenic
1018256213 6:161922219-161922241 TAGAACAAGGAAGAGAAGTGAGG - Intronic
1018851982 6:167647280-167647302 CTGAAGGTGGAAGTGAAGTGTGG - Intergenic
1018927511 6:168216822-168216844 CAAAGGATGGGAAAGAAATGGGG - Intergenic
1019041080 6:169106737-169106759 CAGAAGAAAGAAAAGAGGGGAGG - Intergenic
1019120972 6:169803042-169803064 CAGAAAATGGAAATGAGGTACGG + Intergenic
1019210585 6:170401461-170401483 CAGAAGCTGGCAGAGAAGAGAGG + Intronic
1019785204 7:2972405-2972427 CAGCAGAAGAAAAAGAAGTAGGG + Intronic
1020322958 7:6953624-6953646 CAGAAGGTGGCAAAGATGTTAGG - Intergenic
1020634242 7:10677323-10677345 CAGCAGATGGAAAAGCAGCTTGG + Intergenic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021226756 7:18036990-18037012 CAGCAGATGAAAATGATGTGAGG - Intergenic
1021542658 7:21777084-21777106 CAGGAGGTGGGGAAGAAGTGGGG - Intronic
1022062525 7:26812169-26812191 CAAAAGAGGGAAAAGAAGTGAGG - Intronic
1022265306 7:28747898-28747920 CAGGAGAGGGAACAGAATTGTGG + Intronic
1022280434 7:28903321-28903343 TAGAAGATGGAAAAAAAGAGTGG + Intergenic
1022578165 7:31518904-31518926 CAGAAGATGCAAAAGAAGTTGGG + Intronic
1022705851 7:32801565-32801587 CAGAAGATGAAAGAGAAGCAAGG + Intergenic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1022885758 7:34642025-34642047 CAGAAAATAGAAAAGAAGATAGG + Intergenic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023059179 7:36312560-36312582 CAGCAGATGGAAAAGAGGTGGGG + Intergenic
1023080416 7:36521324-36521346 AAGAAGAAGAAAAAGAAGTGGGG - Intronic
1023275455 7:38514660-38514682 CACAAAACGGAAAAGAAGTCAGG - Intronic
1023583069 7:41701984-41702006 CAGAAAATGAAAAAGAGGGGAGG - Intronic
1023719288 7:43076653-43076675 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1025164002 7:56694472-56694494 CAGAATCTGGAAATGAAATGAGG + Intergenic
1025706288 7:63867610-63867632 CAGAATCTGGAAATGAAATGAGG - Intergenic
1025765211 7:64440026-64440048 CAGAGGCTGGAAAGGATGTGGGG + Intergenic
1026357880 7:69575514-69575536 AAAAAGAGAGAAAAGAAGTGTGG - Intergenic
1026638334 7:72103745-72103767 GAGAAGATGGAAATGGAGGGGGG + Intronic
1027689352 7:81322754-81322776 AAGAAGATAGAAAAGAAGGAGGG - Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027933674 7:84574323-84574345 CAGAAAATCCAAAATAAGTGTGG + Intergenic
1028950586 7:96630663-96630685 CAGAGGATGGAAAAGTAAAGGGG - Intronic
1030106147 7:105989220-105989242 CAGAAAGTGGAGAAGAGGTGGGG - Intronic
1030465933 7:109903857-109903879 CAGGAGATGAGAAGGAAGTGTGG - Intergenic
1030736574 7:113055755-113055777 CAGAAGCTAGGCAAGAAGTGTGG + Intergenic
1030759086 7:113328593-113328615 GGGAAGAAGAAAAAGAAGTGAGG + Intergenic
1030802467 7:113869095-113869117 AAGAAGATAGAAAAGAAGAGAGG + Intergenic
1030932736 7:115545108-115545130 CAGAAGGTGGGAAAGGAGTAAGG + Intergenic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1031119074 7:117700022-117700044 CAGGAGATGGAGAAGATGTTGGG + Intronic
1032986892 7:137347088-137347110 CAGAAGACTTAAAAGAATTGAGG + Intergenic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1035274282 7:157737993-157738015 CAGGAGATGGATGAGAAGAGAGG - Intronic
1035426336 7:158777568-158777590 CAGAAGATGAAGGGGAAGTGAGG - Intronic
1035432582 7:158833459-158833481 CAGACATGGGAAAAGAAGTGTGG + Intergenic
1035639686 8:1175094-1175116 CAGAAGGTAGCAAAAAAGTGTGG - Intergenic
1035854998 8:2965035-2965057 CAGAGGAAGGACAAGAAGAGGGG - Intronic
1036263065 8:7255498-7255520 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036264369 8:7263121-7263143 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036265664 8:7270743-7270765 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036268272 8:7285987-7286009 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036269576 8:7293609-7293631 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036298317 8:7553446-7553468 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036299622 8:7561096-7561118 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036300926 8:7568742-7568764 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036302234 8:7576392-7576414 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036303525 8:7584036-7584058 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036315104 8:7714038-7714060 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036316412 8:7721684-7721706 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036317719 8:7729332-7729354 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036319028 8:7736980-7737002 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036320336 8:7744627-7744649 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036321644 8:7752275-7752297 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036322954 8:7759923-7759945 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036324256 8:7767572-7767594 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036351784 8:8016735-8016757 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036353085 8:8024381-8024403 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036354378 8:8032028-8032050 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036777251 8:11622109-11622131 AAGAAGAAGAAGAAGAAGTGAGG - Intergenic
1036835641 8:12063328-12063350 CTTAAGATGGCAAAGAAGAGAGG + Intergenic
1036857484 8:12309901-12309923 CTTAAGATGGCAAAGAAGAGAGG + Intergenic
1037189852 8:16110978-16111000 CAGAAGAAGGAAAAGAAAAAAGG + Intronic
1037635491 8:20698146-20698168 AAGCAGATGGAGATGAAGTGAGG - Intergenic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1038194521 8:25354627-25354649 CATAAGAAGGAAAAAAAGTGAGG + Intronic
1038464991 8:27753647-27753669 CAGAAGATGGAAAATACTGGTGG - Intronic
1038838147 8:31151687-31151709 CAGAAGAGGAAAATGAAGTAGGG + Intronic
1039124833 8:34189753-34189775 CAGCAAAAGGAAAAGAAGAGGGG - Intergenic
1039179625 8:34851141-34851163 GAGAAGAGGAGAAAGAAGTGGGG - Intergenic
1039444201 8:37617885-37617907 CAAAGTCTGGAAAAGAAGTGGGG + Intergenic
1039534168 8:38293151-38293173 AAGAAAAAGAAAAAGAAGTGGGG + Intronic
1039778906 8:40764346-40764368 CAGAAGATAGAAATGAATTTGGG + Intronic
1040106560 8:43545348-43545370 CAGGACATGGAAAAAAAGAGCGG - Intergenic
1040345238 8:46485968-46485990 CAGGAGATGGACAAGCCGTGTGG - Intergenic
1040698726 8:50035330-50035352 GAGAAGTTGGAAAAGAACAGAGG - Intronic
1040975938 8:53194723-53194745 GAGAATATGGAAAATAGGTGTGG - Intergenic
1041211940 8:55560216-55560238 GAGAAGAAGGAAGAGCAGTGTGG - Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041751492 8:61265797-61265819 CATAAGATGGGAAAGAAGGCAGG - Intronic
1042473122 8:69213864-69213886 CAGAGGAAAGAAGAGAAGTGTGG - Intergenic
1042492668 8:69417955-69417977 TAGAAGATAAAAAAGAATTGTGG - Intergenic
1042648442 8:71013148-71013170 CAGAAGCTGCCTAAGAAGTGAGG + Intergenic
1043138146 8:76553732-76553754 CAGAAGAAGAAAAAGCACTGTGG + Intergenic
1043311567 8:78866173-78866195 CAGATGCTGGCAAGGAAGTGGGG - Intergenic
1043332524 8:79134891-79134913 TAGAAGATGGAAAAGATGATTGG + Intergenic
1043559107 8:81469729-81469751 AACAAGATGCAGAAGAAGTGGGG + Intergenic
1044433637 8:92136719-92136741 CAGGAGATGAAAGTGAAGTGGGG - Intergenic
1045265692 8:100617031-100617053 CAGCAGATGGAAAAGGGGTCTGG + Intronic
1045704117 8:104900244-104900266 AAGAAGAGGGAAAAAAAGAGAGG - Intronic
1045904314 8:107324604-107324626 AGGAAGAGGAAAAAGAAGTGTGG + Intronic
1046293211 8:112189560-112189582 AAGAAGATGGAAAATAACTTTGG + Intergenic
1046662852 8:116967266-116967288 AAGTAGATGGAAGAGAAGAGAGG + Intronic
1047807766 8:128377542-128377564 CAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1048172170 8:132117665-132117687 CAGAAGAGGGAAAGAGAGTGAGG + Intergenic
1048210891 8:132453374-132453396 CAGAAGACAGAAGAGAAGTCAGG + Intronic
1048264146 8:132970866-132970888 TAGGAGATGGAAAAGCAGAGAGG + Intronic
1048465597 8:134662388-134662410 GAGAAGGTGGAAGAGAAGAGGGG + Intronic
1048484541 8:134834373-134834395 CAGAAGTAGGAAATGCAGTGAGG + Intergenic
1048563015 8:135563054-135563076 CTGAAAATGGAAGAGTAGTGTGG - Intronic
1048838918 8:138547545-138547567 GAGAAGGTGAAAGAGAAGTGGGG - Intergenic
1048980466 8:139701182-139701204 CAGAAGCTGGAAACACAGTGTGG + Intronic
1049236804 8:141516251-141516273 CAGGAGACGGAAGGGAAGTGGGG - Intronic
1049566294 8:143340858-143340880 ACGAGGATGTAAAAGAAGTGTGG - Intronic
1049968413 9:799901-799923 CAGCAGATGGAAAATATTTGGGG + Intergenic
1050909861 9:11055130-11055152 CAGAAGACAGAAAAAAAATGTGG + Intergenic
1051169408 9:14304228-14304250 ATGAAGAAGGAAAAAAAGTGTGG + Intronic
1051431083 9:16981115-16981137 CAGGAGTTGTAAAAGTAGTGTGG - Intergenic
1051574988 9:18605105-18605127 CAGAAGAGGGAAAAAAGGTAGGG - Intronic
1051696686 9:19775311-19775333 CATCAGGTGGAAAAGAAATGTGG - Intronic
1051857958 9:21591050-21591072 CAGAAGAAGAAAAAGAAAAGAGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052127581 9:24796849-24796871 AAGAAGAGGGAGAAGATGTGGGG + Intergenic
1052469017 9:28869422-28869444 CAGAGGATGAACAAGGAGTGGGG + Intergenic
1053054825 9:34988142-34988164 AGGAGGATGGAAAGGAAGTGGGG - Intergenic
1053450826 9:38192757-38192779 CAGAGGCTGGGGAAGAAGTGGGG + Intergenic
1053484081 9:38439116-38439138 CAGTGGATGGAAAAGACCTGAGG + Intergenic
1053619848 9:39803739-39803761 CAGAAGCTAGGAGAGAAGTGTGG - Intergenic
1053878027 9:42563054-42563076 CAGAAGCTAGGAGAGAAGTGTGG - Intergenic
1053894637 9:42731311-42731333 CAGAAGCTAGGAGAGAAGTGTGG + Intergenic
1054233668 9:62538640-62538662 CAGAAGCTAGGAGAGAAGTGTGG + Intergenic
1054264309 9:62903704-62903726 CAGAAGCTAGGAGAGAAGTGTGG + Intergenic
1055598323 9:77888710-77888732 CAGATTTTGGAAAAAAAGTGAGG + Intronic
1056052455 9:82783523-82783545 TACAAGAGGGAAAAGAATTGAGG - Intergenic
1056184979 9:84125646-84125668 CAGAATATGGGAAAGAAAGGTGG + Intergenic
1056765335 9:89441568-89441590 CAGACCATGGGAAGGAAGTGAGG + Intronic
1057066854 9:92061050-92061072 CAGAAGAAGAGAAAGAGGTGGGG + Intronic
1057785093 9:98081381-98081403 CAGAATATGTAACAGGAGTGAGG + Intronic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1058160876 9:101569392-101569414 CTGAAGATGGAAAAGACCTGAGG + Exonic
1058447512 9:105066871-105066893 TAGAAGATGGAGAAGCCGTGTGG + Intergenic
1058741101 9:107943362-107943384 CGGAACATGGAAGAGAAGAGAGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059531650 9:115040816-115040838 CAGCAGCTGGAAAAAAAGGGGGG - Intronic
1059568312 9:115406745-115406767 CAGCTGATGGAAAAGAAGTTGGG + Intergenic
1059759644 9:117325757-117325779 GAGAGGCTGGAAAAGGAGTGAGG + Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1059842052 9:118228616-118228638 CTGAAGAGGGAGAAGAAGTTTGG + Intergenic
1060492822 9:124097442-124097464 CAGAAGGTGGAGGAGAGGTGGGG + Intergenic
1060769445 9:126320823-126320845 CTGAAGATGTCAAAGAAGTGTGG + Intergenic
1060875262 9:127078545-127078567 CAGTAGAAGGAAAACATGTGGGG + Intronic
1061083193 9:128384485-128384507 CAGAAGCTGGAAAGGGAATGAGG - Intronic
1061640700 9:131952631-131952653 TGGAAGGTGGAAAAGCAGTGAGG + Intronic
1061700678 9:132412792-132412814 GAGAAAATGGAAAATATGTGAGG + Intronic
1203794469 EBV:169300-169322 CAGGAAATGGAAAGGCAGTGCGG + Intergenic
1185665941 X:1765709-1765731 CAAAAGAAGAAAAAGTAGTGAGG + Intergenic
1185794069 X:2949834-2949856 CAGGAGATTGCAAAGAAGTGTGG + Intronic
1185971206 X:4666638-4666660 CAGCAGATGGAGCAGAATTGAGG + Intergenic
1186074007 X:5856326-5856348 AAGAAGAAGGAAAACAAGAGTGG + Intronic
1186227250 X:7412868-7412890 CAGCAGATGTAACAGGAGTGTGG - Intergenic
1186526879 X:10257095-10257117 CAGAAGGTGGAAAAGGATTCAGG - Intergenic
1186662745 X:11685618-11685640 GTGAAGATGCAAAAGAAGTAAGG - Intergenic
1187385936 X:18848367-18848389 CAGAGGCTGGAAAAGCAGTGAGG + Intergenic
1187441879 X:19328082-19328104 CAAAAGATGGAAGCCAAGTGGGG - Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1187554486 X:20339013-20339035 CAGGTGATGGCAAAGAAGAGGGG - Intergenic
1187604790 X:20871379-20871401 CAGAAGATGGGAAATAAATTCGG + Intergenic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1187827965 X:23351922-23351944 CAGAAGGTGGAAAGGACATGGGG + Intronic
1188878180 X:35458630-35458652 GAGAGGATAGAAAAGGAGTGGGG + Intergenic
1189193692 X:39134109-39134131 CAGAACATGCAACAGAGGTGTGG + Intergenic
1189729307 X:44002223-44002245 CAGGAGATAGAAATGAAGAGTGG + Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190520276 X:51272170-51272192 CAGGAGGGGAAAAAGAAGTGTGG + Intergenic
1190738252 X:53269886-53269908 CAGTAGGAGGAAAAGCAGTGGGG - Intronic
1190994225 X:55589938-55589960 CAGGGGCTGGAAATGAAGTGGGG + Intergenic
1192163006 X:68802694-68802716 CAGAGGATGGTAAGCAAGTGAGG - Intergenic
1192429866 X:71104548-71104570 GAGAAGATGGCCAAGAAATGGGG + Intronic
1192656007 X:72995654-72995676 CAGAGGCTGGAAAAGTAGTGGGG + Intergenic
1192812505 X:74559716-74559738 GAGGAGAGGGAAAAGAGGTGAGG + Intergenic
1192930331 X:75799744-75799766 AAGAAGAAGGAAGAGTAGTGTGG - Intergenic
1193873489 X:86831372-86831394 AAGAAGTAGGAAAAGAAATGTGG - Intronic
1194218908 X:91167557-91167579 AAGAAGAGGGAAAAGTAGAGGGG - Intergenic
1194265051 X:91743400-91743422 AAGAAGAGGGAAAAGAAAAGGGG - Intergenic
1194423732 X:93710122-93710144 AAGAAGAAGAAAAAGAAGTCTGG + Exonic
1194813964 X:98419845-98419867 TAGAAGATGGAAGAGAAAGGAGG - Intergenic
1195680441 X:107542015-107542037 CAGATGATGGCAGAGAAGAGAGG + Intronic
1195839887 X:109163014-109163036 CAGAAGATGGGAAAGCTGTGAGG - Intergenic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196524878 X:116720164-116720186 CAGAAGAAGACAAAGATGTGGGG + Intergenic
1196748591 X:119094250-119094272 CAAAAGAAGAAAAAGAATTGGGG + Intronic
1197128885 X:122980626-122980648 CAGAAGATGAAAAAGAAGACAGG + Intergenic
1197177373 X:123500303-123500325 CACAAGCTGGCAAAGCAGTGGGG + Intergenic
1197327240 X:125108997-125109019 CAGAAGATGCAAATGAATAGAGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198169375 X:134090760-134090782 CACAAGTTTGAAAAGAAGGGAGG + Intergenic
1198488703 X:137115858-137115880 TAGAAGATGGGAAACAAGTTAGG + Intergenic
1198661680 X:138975689-138975711 CAAAAGATGGCAAAAAAGTGTGG + Intronic
1199563143 X:149185738-149185760 CAGAATATGTAAATGAATTGTGG + Intergenic
1199810310 X:151342583-151342605 AAGAAGATGGAAAAGAAATGAGG + Intergenic
1200082590 X:153585875-153585897 GAGAAAAGAGAAAAGAAGTGGGG + Intergenic
1200112550 X:153749199-153749221 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1200555420 Y:4631313-4631335 AAGAAGAGGGAAAAGTAGAGGGG - Intergenic
1200812099 Y:7496744-7496766 CTTAAGATGGAAAAAAAATGGGG - Intergenic
1200948390 Y:8868206-8868228 CAGAAGATAGCAAAGTATTGGGG + Intergenic
1201621144 Y:15959708-15959730 CAGAAGCTGGAGAGGATGTGGGG + Intergenic
1201927406 Y:19302811-19302833 AAGAAGAAGGAAAAGAAGCAAGG - Intergenic
1202336878 Y:23821146-23821168 CAGGAGATGGATAAAATGTGTGG - Intergenic
1202353388 Y:24018499-24018521 CAGAAGATGGATAAACTGTGTGG - Intergenic
1202517391 Y:25651616-25651638 CAGAAGATGGATAAACTGTGTGG + Intergenic
1202533887 Y:25848925-25848947 CAGGAGATGGATAAAATGTGTGG + Intergenic