ID: 1187545580 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:20248641-20248663 |
| Sequence | GTTTATACAAAAAATTAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 30440 | |||
| Summary | {0: 1, 1: 12, 2: 228, 3: 2109, 4: 28090} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187545580_1187545582 | 29 | Left | 1187545580 | X:20248641-20248663 | CCCAGCTAATTTTTTGTATAAAC | 0: 1 1: 12 2: 228 3: 2109 4: 28090 |
||
| Right | 1187545582 | X:20248693-20248715 | TCAAATGATCATAAAGTCACAGG | 0: 1 1: 0 2: 1 3: 17 4: 237 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187545580 | Original CRISPR | GTTTATACAAAAAATTAGCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||