ID: 1187545580

View in Genome Browser
Species Human (GRCh38)
Location X:20248641-20248663
Sequence GTTTATACAAAAAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30440
Summary {0: 1, 1: 12, 2: 228, 3: 2109, 4: 28090}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187545580_1187545582 29 Left 1187545580 X:20248641-20248663 CCCAGCTAATTTTTTGTATAAAC 0: 1
1: 12
2: 228
3: 2109
4: 28090
Right 1187545582 X:20248693-20248715 TCAAATGATCATAAAGTCACAGG 0: 1
1: 0
2: 1
3: 17
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187545580 Original CRISPR GTTTATACAAAAAATTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr