ID: 1187550465

View in Genome Browser
Species Human (GRCh38)
Location X:20297877-20297899
Sequence CTCAATATAAAAATGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4383
Summary {0: 3, 1: 29, 2: 257, 3: 904, 4: 3190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187550465 Original CRISPR CTCAATATAAAAATGGGCAA AGG Intergenic
Too many off-targets to display for this crispr