ID: 1187552646

View in Genome Browser
Species Human (GRCh38)
Location X:20321638-20321660
Sequence CATTCTAGGCAGAAGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187552643_1187552646 -5 Left 1187552643 X:20321620-20321642 CCTGAAATGGGGACAGGGCATTC No data
Right 1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG No data
1187552642_1187552646 -4 Left 1187552642 X:20321619-20321641 CCCTGAAATGGGGACAGGGCATT No data
Right 1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187552646 Original CRISPR CATTCTAGGCAGAAGGTACA TGG Intergenic
No off target data available for this crispr