ID: 1187562354

View in Genome Browser
Species Human (GRCh38)
Location X:20414743-20414765
Sequence CAGAATCCACAGGATGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187562354_1187562360 25 Left 1187562354 X:20414743-20414765 CCATGCTCATCCTGTGGATTCTG No data
Right 1187562360 X:20414791-20414813 CAGCTCTCACTCCTGTACCCAGG No data
1187562354_1187562358 -4 Left 1187562354 X:20414743-20414765 CCATGCTCATCCTGTGGATTCTG No data
Right 1187562358 X:20414762-20414784 TCTGTCCTTATGGTGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187562354 Original CRISPR CAGAATCCACAGGATGAGCA TGG (reversed) Intergenic
No off target data available for this crispr