ID: 1187562487

View in Genome Browser
Species Human (GRCh38)
Location X:20415639-20415661
Sequence CGTGCATCAGAATCCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187562487_1187562489 6 Left 1187562487 X:20415639-20415661 CCTCCAGGGGATTCTGATGCACG No data
Right 1187562489 X:20415668-20415690 TGTGAGAACCACTGCTACAGAGG No data
1187562487_1187562491 29 Left 1187562487 X:20415639-20415661 CCTCCAGGGGATTCTGATGCACG No data
Right 1187562491 X:20415691-20415713 ACAATTGACATTCATACGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187562487 Original CRISPR CGTGCATCAGAATCCCCTGG AGG (reversed) Intergenic