ID: 1187562822

View in Genome Browser
Species Human (GRCh38)
Location X:20418619-20418641
Sequence AGAGGCCCCTCTTACCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187562822_1187562828 -7 Left 1187562822 X:20418619-20418641 CCTCTAGGGTAAGAGGGGCCTCT No data
Right 1187562828 X:20418635-20418657 GGCCTCTCCTTGGGGGCTGTGGG No data
1187562822_1187562833 24 Left 1187562822 X:20418619-20418641 CCTCTAGGGTAAGAGGGGCCTCT No data
Right 1187562833 X:20418666-20418688 TTCTTTTTAGGCTTTCTCTGTGG No data
1187562822_1187562827 -8 Left 1187562822 X:20418619-20418641 CCTCTAGGGTAAGAGGGGCCTCT No data
Right 1187562827 X:20418634-20418656 GGGCCTCTCCTTGGGGGCTGTGG No data
1187562822_1187562832 12 Left 1187562822 X:20418619-20418641 CCTCTAGGGTAAGAGGGGCCTCT No data
Right 1187562832 X:20418654-20418676 TGGGGTGTGTTATTCTTTTTAGG No data
1187562822_1187562829 -6 Left 1187562822 X:20418619-20418641 CCTCTAGGGTAAGAGGGGCCTCT No data
Right 1187562829 X:20418636-20418658 GCCTCTCCTTGGGGGCTGTGGGG No data
1187562822_1187562834 29 Left 1187562822 X:20418619-20418641 CCTCTAGGGTAAGAGGGGCCTCT No data
Right 1187562834 X:20418671-20418693 TTTAGGCTTTCTCTGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187562822 Original CRISPR AGAGGCCCCTCTTACCCTAG AGG (reversed) Intergenic
No off target data available for this crispr