ID: 1187562830

View in Genome Browser
Species Human (GRCh38)
Location X:20418637-20418659
Sequence ACCCCACAGCCCCCAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187562830_1187562834 11 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562834 X:20418671-20418693 TTTAGGCTTTCTCTGTGGTGAGG No data
1187562830_1187562837 28 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562837 X:20418688-20418710 GTGAGGAGGGTGCAATAGAAAGG No data
1187562830_1187562832 -6 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562832 X:20418654-20418676 TGGGGTGTGTTATTCTTTTTAGG No data
1187562830_1187562835 14 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562835 X:20418674-20418696 AGGCTTTCTCTGTGGTGAGGAGG No data
1187562830_1187562833 6 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562833 X:20418666-20418688 TTCTTTTTAGGCTTTCTCTGTGG No data
1187562830_1187562836 15 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562836 X:20418675-20418697 GGCTTTCTCTGTGGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187562830 Original CRISPR ACCCCACAGCCCCCAAGGAG AGG (reversed) Intergenic
No off target data available for this crispr