ID: 1187562831

View in Genome Browser
Species Human (GRCh38)
Location X:20418642-20418664
Sequence AACACACCCCACAGCCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187562831_1187562835 9 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562835 X:20418674-20418696 AGGCTTTCTCTGTGGTGAGGAGG No data
1187562831_1187562837 23 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562837 X:20418688-20418710 GTGAGGAGGGTGCAATAGAAAGG No data
1187562831_1187562836 10 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562836 X:20418675-20418697 GGCTTTCTCTGTGGTGAGGAGGG No data
1187562831_1187562834 6 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562834 X:20418671-20418693 TTTAGGCTTTCTCTGTGGTGAGG No data
1187562831_1187562838 30 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562838 X:20418695-20418717 GGGTGCAATAGAAAGGCATCTGG No data
1187562831_1187562833 1 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562833 X:20418666-20418688 TTCTTTTTAGGCTTTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187562831 Original CRISPR AACACACCCCACAGCCCCCA AGG (reversed) Intergenic
No off target data available for this crispr