ID: 1187562836

View in Genome Browser
Species Human (GRCh38)
Location X:20418675-20418697
Sequence GGCTTTCTCTGTGGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187562830_1187562836 15 Left 1187562830 X:20418637-20418659 CCTCTCCTTGGGGGCTGTGGGGT No data
Right 1187562836 X:20418675-20418697 GGCTTTCTCTGTGGTGAGGAGGG No data
1187562831_1187562836 10 Left 1187562831 X:20418642-20418664 CCTTGGGGGCTGTGGGGTGTGTT No data
Right 1187562836 X:20418675-20418697 GGCTTTCTCTGTGGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187562836 Original CRISPR GGCTTTCTCTGTGGTGAGGA GGG Intergenic
No off target data available for this crispr