ID: 1187564440

View in Genome Browser
Species Human (GRCh38)
Location X:20434493-20434515
Sequence GGGTCTAGATCTAGAATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187564434_1187564440 15 Left 1187564434 X:20434455-20434477 CCAGGTGATGCTGATGCTGCTGG No data
Right 1187564440 X:20434493-20434515 GGGTCTAGATCTAGAATAGATGG No data
1187564439_1187564440 -10 Left 1187564439 X:20434480-20434502 CCTGGAGTAGCAAGGGTCTAGAT No data
Right 1187564440 X:20434493-20434515 GGGTCTAGATCTAGAATAGATGG No data
1187564433_1187564440 16 Left 1187564433 X:20434454-20434476 CCCAGGTGATGCTGATGCTGCTG 0: 143
1: 518
2: 1064
3: 1639
4: 2403
Right 1187564440 X:20434493-20434515 GGGTCTAGATCTAGAATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187564440 Original CRISPR GGGTCTAGATCTAGAATAGA TGG Intergenic