ID: 1187564440 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:20434493-20434515 |
| Sequence | GGGTCTAGATCTAGAATAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187564434_1187564440 | 15 | Left | 1187564434 | X:20434455-20434477 | CCAGGTGATGCTGATGCTGCTGG | No data | ||
| Right | 1187564440 | X:20434493-20434515 | GGGTCTAGATCTAGAATAGATGG | No data | ||||
| 1187564439_1187564440 | -10 | Left | 1187564439 | X:20434480-20434502 | CCTGGAGTAGCAAGGGTCTAGAT | No data | ||
| Right | 1187564440 | X:20434493-20434515 | GGGTCTAGATCTAGAATAGATGG | No data | ||||
| 1187564433_1187564440 | 16 | Left | 1187564433 | X:20434454-20434476 | CCCAGGTGATGCTGATGCTGCTG | 0: 143 1: 518 2: 1064 3: 1639 4: 2403 |
||
| Right | 1187564440 | X:20434493-20434515 | GGGTCTAGATCTAGAATAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187564440 | Original CRISPR | GGGTCTAGATCTAGAATAGA TGG | Intergenic | ||