ID: 1187565774

View in Genome Browser
Species Human (GRCh38)
Location X:20448108-20448130
Sequence TCTCACATACTCTCGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187565771_1187565774 -7 Left 1187565771 X:20448092-20448114 CCTTATGCACAGTGATTCTCACA No data
Right 1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG No data
1187565768_1187565774 29 Left 1187565768 X:20448056-20448078 CCATTGGGAGCCTAGTGATGTTT No data
Right 1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG No data
1187565769_1187565774 19 Left 1187565769 X:20448066-20448088 CCTAGTGATGTTTACACTAGTTC No data
Right 1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG No data
1187565767_1187565774 30 Left 1187565767 X:20448055-20448077 CCCATTGGGAGCCTAGTGATGTT No data
Right 1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187565774 Original CRISPR TCTCACATACTCTCGGTGGT AGG Intergenic
No off target data available for this crispr