ID: 1187567035

View in Genome Browser
Species Human (GRCh38)
Location X:20461021-20461043
Sequence CTGTAGAGATGGAGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187567035_1187567037 -7 Left 1187567035 X:20461021-20461043 CCATCTGTTCTCCATCTCTACAG No data
Right 1187567037 X:20461037-20461059 TCTACAGTTTTGCCTTTTCCAGG No data
1187567035_1187567039 8 Left 1187567035 X:20461021-20461043 CCATCTGTTCTCCATCTCTACAG No data
Right 1187567039 X:20461052-20461074 TTTCCAGGAAGCCATGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187567035 Original CRISPR CTGTAGAGATGGAGAACAGA TGG (reversed) Intergenic
No off target data available for this crispr