ID: 1187570948

View in Genome Browser
Species Human (GRCh38)
Location X:20501069-20501091
Sequence AAGGGAACATTCAGGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187570948_1187570958 19 Left 1187570948 X:20501069-20501091 CCATCAGCCCTGAATGTTCCCTT No data
Right 1187570958 X:20501111-20501133 CCTCCCCCCATTCCTGGCCTAGG No data
1187570948_1187570955 13 Left 1187570948 X:20501069-20501091 CCATCAGCCCTGAATGTTCCCTT No data
Right 1187570955 X:20501105-20501127 GTCAACCCTCCCCCCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187570948 Original CRISPR AAGGGAACATTCAGGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr