ID: 1187571182

View in Genome Browser
Species Human (GRCh38)
Location X:20504204-20504226
Sequence GTCCTGAATAACCACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187571182_1187571184 24 Left 1187571182 X:20504204-20504226 CCAAGATGGTGGTTATTCAGGAC No data
Right 1187571184 X:20504251-20504273 AGAACTGAAGATATTTTTTTTGG No data
1187571182_1187571183 -4 Left 1187571182 X:20504204-20504226 CCAAGATGGTGGTTATTCAGGAC No data
Right 1187571183 X:20504223-20504245 GGACTGTGTTATATGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187571182 Original CRISPR GTCCTGAATAACCACCATCT TGG (reversed) Intergenic
No off target data available for this crispr