ID: 1187573412

View in Genome Browser
Species Human (GRCh38)
Location X:20529211-20529233
Sequence TGGCCATCATCAAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187573409_1187573412 -9 Left 1187573409 X:20529197-20529219 CCCCAGCACACTGCTGGCCATCA No data
Right 1187573412 X:20529211-20529233 TGGCCATCATCAAGACTTGAAGG No data
1187573406_1187573412 23 Left 1187573406 X:20529165-20529187 CCTTGGTAGGAAAACAAATGAGC No data
Right 1187573412 X:20529211-20529233 TGGCCATCATCAAGACTTGAAGG No data
1187573410_1187573412 -10 Left 1187573410 X:20529198-20529220 CCCAGCACACTGCTGGCCATCAT No data
Right 1187573412 X:20529211-20529233 TGGCCATCATCAAGACTTGAAGG No data
1187573408_1187573412 -5 Left 1187573408 X:20529193-20529215 CCATCCCCAGCACACTGCTGGCC No data
Right 1187573412 X:20529211-20529233 TGGCCATCATCAAGACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187573412 Original CRISPR TGGCCATCATCAAGACTTGA AGG Intergenic