ID: 1187576033

View in Genome Browser
Species Human (GRCh38)
Location X:20556512-20556534
Sequence GCATCCAGATGTGCAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187576026_1187576033 13 Left 1187576026 X:20556476-20556498 CCATCACAACATTATTTGTACTA No data
Right 1187576033 X:20556512-20556534 GCATCCAGATGTGCAGCACCAGG No data
1187576025_1187576033 14 Left 1187576025 X:20556475-20556497 CCCATCACAACATTATTTGTACT No data
Right 1187576033 X:20556512-20556534 GCATCCAGATGTGCAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187576033 Original CRISPR GCATCCAGATGTGCAGCACC AGG Intergenic
No off target data available for this crispr