ID: 1187579269

View in Genome Browser
Species Human (GRCh38)
Location X:20591452-20591474
Sequence CTCTGCCAGTGGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187579269_1187579276 -7 Left 1187579269 X:20591452-20591474 CCCTCCCCTTTCCACTGGCAGAG No data
Right 1187579276 X:20591468-20591490 GGCAGAGGAGCTTCTCTGTGTGG No data
1187579269_1187579277 9 Left 1187579269 X:20591452-20591474 CCCTCCCCTTTCCACTGGCAGAG No data
Right 1187579277 X:20591484-20591506 TGTGTGGCCACCACCAGCACTGG No data
1187579269_1187579280 19 Left 1187579269 X:20591452-20591474 CCCTCCCCTTTCCACTGGCAGAG No data
Right 1187579280 X:20591494-20591516 CCACCAGCACTGGTCCACTGAGG No data
1187579269_1187579281 20 Left 1187579269 X:20591452-20591474 CCCTCCCCTTTCCACTGGCAGAG No data
Right 1187579281 X:20591495-20591517 CACCAGCACTGGTCCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187579269 Original CRISPR CTCTGCCAGTGGAAAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr