ID: 1187579422

View in Genome Browser
Species Human (GRCh38)
Location X:20592506-20592528
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 2, 1: 21, 2: 37, 3: 121, 4: 490}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187579422_1187579429 25 Left 1187579422 X:20592506-20592528 CCTCCAGTCACTGTGCTCTTCCT 0: 2
1: 21
2: 37
3: 121
4: 490
Right 1187579429 X:20592554-20592576 TGTGCAGCAAGGCCACTGCCAGG No data
1187579422_1187579428 14 Left 1187579422 X:20592506-20592528 CCTCCAGTCACTGTGCTCTTCCT 0: 2
1: 21
2: 37
3: 121
4: 490
Right 1187579428 X:20592543-20592565 GATTCTCTCTCTGTGCAGCAAGG No data
1187579422_1187579430 26 Left 1187579422 X:20592506-20592528 CCTCCAGTCACTGTGCTCTTCCT 0: 2
1: 21
2: 37
3: 121
4: 490
Right 1187579430 X:20592555-20592577 GTGCAGCAAGGCCACTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187579422 Original CRISPR AGGAAGAGCACAGTGACTGG AGG (reversed) Intergenic
900616045 1:3566137-3566159 AAGAACAGGACAGTGACTGCAGG - Intronic
901102052 1:6726476-6726498 AGGAAGAGCATTGTAGCTGGAGG - Intergenic
901772427 1:11537170-11537192 AGGAAGAGCACAGTGGATCCAGG + Exonic
902197603 1:14809371-14809393 AGGAAGAGCAAAGTCACAGAGGG - Intronic
903600667 1:24536582-24536604 GGAAACAGCACAGTGAGTGGAGG - Exonic
904381086 1:30111665-30111687 GGGCAGAGCTCAGTGGCTGGAGG - Intergenic
904419891 1:30384801-30384823 AGGAAGAACACAGACTCTGGAGG + Intergenic
904459492 1:30667734-30667756 AGGCAGAGCACACTGGCAGGCGG - Intergenic
904981723 1:34509115-34509137 ATAAAGAGAACAGTAACTGGAGG + Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906709184 1:47916424-47916446 GGGATGAGCACTGTGACTGAGGG + Intronic
908432834 1:64075549-64075571 ATGTATAGGACAGTGACTGGAGG - Intronic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909512607 1:76471785-76471807 AGGAAGAGCAAAATGACAAGAGG - Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910087192 1:83417553-83417575 AGGAAAAGTACAGAGATTGGAGG - Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911250670 1:95572942-95572964 TGGAAGAGCCCCGTGGCTGGTGG - Intergenic
911655021 1:100434333-100434355 AGGAAGAGCCCAGTGGCTACTGG + Intronic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912064933 1:105725855-105725877 AAGAAGAACACAGTGGCTTGGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
916988706 1:170218884-170218906 AGGAAGAGGAGTATGACTGGTGG - Intergenic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918218967 1:182418403-182418425 AGGAGGTGCCCAGTAACTGGGGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919122293 1:193356347-193356369 AGCCAGAACATAGTGACTGGTGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919257592 1:195143401-195143423 GGGGAGAGCACAGGGACCGGAGG - Intergenic
919506681 1:198407706-198407728 AGGAAGTTCACAGTGCCTGCAGG - Intergenic
919752004 1:201043541-201043563 AGGAGAAGAGCAGTGACTGGGGG + Intronic
919793659 1:201308358-201308380 AGCAAGAGCTCAGTGAAAGGTGG - Intronic
919833683 1:201559387-201559409 TGGAAGAGCACTGTTCCTGGTGG - Intergenic
920510752 1:206550306-206550328 AGGATTAGAACAGTGCCTGGGGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921264753 1:213412889-213412911 AGAAAGAGCACTGTGGCTGGGGG - Intergenic
921524852 1:216204215-216204237 AGGAAGTGAACAGTTATTGGAGG - Intronic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
922001319 1:221481314-221481336 AGGAAGTGCTCAGTAAATGGTGG - Intergenic
922035399 1:221842854-221842876 AGGAAAGGCACACTGTCTGGAGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922436587 1:225613413-225613435 GGGCAGAGAACAGTGCCTGGTGG + Intronic
923378642 1:233392290-233392312 AGGAAGAGAAAATTCACTGGTGG - Intergenic
923538211 1:234869352-234869374 TGGAAGAGAGCAGTGCCTGGAGG - Intergenic
924010437 1:239659403-239659425 AGGAATGGGACAGTGGCTGGAGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063233764 10:4091058-4091080 CAGAAAAGCACAGTGCCTGGAGG + Intergenic
1065374462 10:25024090-25024112 AGAAAGAGCACAGATACTGTTGG + Exonic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067299189 10:44993687-44993709 AGGAAGAGGACAGGGGCTTGTGG - Exonic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069555898 10:69398489-69398511 TGGATGAGTACAGTGATTGGGGG + Intronic
1069631012 10:69897074-69897096 GGGAAGAGCACAGTGACAGAAGG + Intronic
1069784530 10:70979204-70979226 GGGAAGTGCACAGTGGCAGGAGG - Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070510074 10:77152919-77152941 AGGAAGCCCTCAGTGAATGGAGG - Intronic
1070571466 10:77642581-77642603 AGGAAGGGCAGGGTTACTGGTGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072265160 10:93720202-93720224 AGGCAGAGCACAGACTCTGGGGG + Intergenic
1073196289 10:101694679-101694701 GGGAAGAGCACAGGGACGAGGGG - Exonic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073863777 10:107777301-107777323 AAGAAGAGCACATGGCCTGGTGG - Intergenic
1074430573 10:113390710-113390732 AGAAAGTTGACAGTGACTGGCGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075228145 10:120648379-120648401 AGGACTAGCACAGAGACTGCTGG - Intergenic
1075262560 10:120975937-120975959 AAGAGGAGCACAGTGAATGAAGG - Intergenic
1075265504 10:120997215-120997237 AGGAAGACCACAGTGTCAGGGGG - Intergenic
1075568823 10:123523897-123523919 AGGAAGAGCTCAGCAAATGGTGG + Intergenic
1075677450 10:124305282-124305304 AGCTAGAGCACAGTGACTCAAGG + Intergenic
1076453068 10:130570340-130570362 AGGAAAAGCAGAGTGGCTTGAGG + Intergenic
1076875953 10:133215617-133215639 AGGATGAGCACAAGGACAGGTGG + Intronic
1076913352 10:133403409-133403431 CGAAGGAGCACAGGGACTGGGGG - Intronic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1078141369 11:8695572-8695594 GGGAAGAGAACAGTCATTGGAGG + Intronic
1078846316 11:15121906-15121928 AGGAAGAGCACAGAGAATCATGG - Intronic
1078855027 11:15200352-15200374 AGGAATAGCATGGTGACTGTTGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080680593 11:34472332-34472354 AGGAAGAGGAAAGTGACCAGTGG - Intergenic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1083690109 11:64402706-64402728 AGGATGAACCCAGTGACTGCTGG + Intergenic
1084071626 11:66740250-66740272 AGGAAGAAAACAGGGAATGGGGG + Intergenic
1084079335 11:66810315-66810337 AGGAAGAGCACTGGAAGTGGTGG + Intronic
1084747783 11:71184160-71184182 AAAAAGAGCATAGTGACAGGTGG - Intronic
1084859894 11:72011447-72011469 AGGAAGAGCACAGGGAGTAGGGG + Intronic
1085152819 11:74265764-74265786 ATGAAGAGCACAGAGCCTAGTGG + Intronic
1085780107 11:79400522-79400544 AGGAAGAGCACAGGGAGGAGAGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1087349930 11:97019149-97019171 AGGAAAAGCACAGATACTAGGGG + Intergenic
1087600473 11:100308447-100308469 AGGAAGACCACAGGGATTTGAGG + Exonic
1088248728 11:107844162-107844184 AGTAAGAGCACAGGCTCTGGGGG + Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088461375 11:110086951-110086973 AGGAAGTGCACAGAAGCTGGAGG - Intergenic
1088594298 11:111428455-111428477 AGGAAGAGGTCCCTGACTGGAGG - Intronic
1088652228 11:111967914-111967936 AGCAAGAGCAGTGTGGCTGGGGG - Intronic
1088742590 11:112779200-112779222 AGGAAGAGCTCAGGGTCTGAAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089682859 11:120129159-120129181 AGGAAGAGGACACAGACTGTTGG + Intronic
1089700462 11:120241057-120241079 AGGAACAGCAAGGTGAATGGAGG - Intronic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1090779407 11:129993988-129994010 ATGAAGAGCACAGTGGCTCAAGG - Intronic
1091909602 12:4218882-4218904 AGGATGGGCACATTGACTGATGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092910758 12:13142942-13142964 AGGAAGAGGAGAGAGGCTGGAGG - Intergenic
1092943948 12:13436035-13436057 AGGAAGGGCAGAGGGAGTGGGGG - Intergenic
1093813233 12:23512357-23512379 GTTAAGAGCTCAGTGACTGGGGG + Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095803838 12:46296716-46296738 AGGAAAAGCAGAAGGACTGGAGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096507624 12:52105148-52105170 AGGAAGGGCACAGTGAGCAGGGG - Intergenic
1096905221 12:54929566-54929588 AGGAAAAGCACTTTGAATGGAGG + Intergenic
1097229057 12:57498121-57498143 AGGAAGAGAACAGTGCATGGGGG - Intronic
1097508517 12:60506933-60506955 AGGAAGAACGCAGCGGCTGGGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1103592423 12:122001751-122001773 ATGAAAAGAACAGTGAGTGGTGG + Intronic
1104310327 12:127649005-127649027 AGGAAGAGCCTGGTGCCTGGAGG - Intergenic
1104737730 12:131148383-131148405 AGGAAGAGAACAGACAGTGGGGG - Intergenic
1105280157 13:18958659-18958681 ACCCTGAGCACAGTGACTGGGGG + Intergenic
1105503596 13:20992023-20992045 GGGAAGAACACAGGGACTGGTGG + Intronic
1105533337 13:21240758-21240780 AGGAAGTGCTCAGTAAGTGGTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106350894 13:28929814-28929836 AGCAAGAGCTGAGTGTCTGGAGG + Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1109117045 13:58401602-58401624 AGGTAGAGCTCTGTGATTGGTGG + Intergenic
1109718681 13:66249418-66249440 AGTAAGGGAACAGTGACAGGTGG + Intergenic
1109914358 13:68961477-68961499 AGCAATAGCACAGTGATAGGAGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112843570 13:103609684-103609706 AGGAAGAACACAGAGCTTGGGGG - Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113616958 13:111686956-111686978 AGAAATAGCACAGTGTCTTGGGG + Intergenic
1113622488 13:111772227-111772249 AGAAATAGCACAGTGTCTTGGGG + Intergenic
1113627394 13:111856999-111857021 AGGAAGAGGAGAGAGACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115820132 14:37205005-37205027 AGCAAAAGCAAAGAGACTGGCGG + Intronic
1115879468 14:37899025-37899047 GGGAAGAGCTGAGTGACTGATGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1116969675 14:51051254-51051276 AGGAAGAGAACAGTGAGAGAGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119142662 14:72281772-72281794 ATGAAGATCAGAGTGGCTGGAGG + Intronic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121544955 14:94756371-94756393 AGAAAGAGCAGAGTGTCTGGTGG + Intergenic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1123838583 15:24223270-24223292 ATGAAGAGAACAGTCTCTGGAGG - Intergenic
1123873890 15:24604652-24604674 ATGAAGAGAACAGTCTCTGGAGG - Intergenic
1124065606 15:26340925-26340947 AGGAGAAGCACAGTGGCAGGAGG + Intergenic
1124651000 15:31473898-31473920 AGGAGGAGCTCAGAGTCTGGGGG - Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1125433055 15:39616801-39616823 AGGAAGAGAAGAGAGACTTGAGG + Intronic
1126565678 15:50096329-50096351 AGGAAGTCCTCTGTGACTGGTGG + Intronic
1126612862 15:50547311-50547333 AGGAAGCACACAGGGACAGGAGG + Intergenic
1128614961 15:69101809-69101831 AGAAAGAGAAGAGTGAATGGAGG - Intergenic
1128708255 15:69852970-69852992 AGGAAGGGCTCAAGGACTGGAGG + Intergenic
1128712085 15:69879594-69879616 AGAAGGAGCACAGGGATTGGGGG - Intergenic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130435763 15:83897852-83897874 TTGAAGTGCACAGTGACTTGTGG + Exonic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130624280 15:85497468-85497490 GGGAAGAGCAGAGTGAGAGGAGG + Intronic
1132128363 15:99251104-99251126 AGGAACAGGTCAGTAACTGGCGG + Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133169362 16:3971640-3971662 AGGAAGAGAATATGGACTGGGGG + Intronic
1133340178 16:5030822-5030844 AGGAAGTGCAAAGTGGCTGCAGG - Intronic
1133370505 16:5242457-5242479 AGGAAGAGGAATGTGTCTGGCGG - Intergenic
1135300141 16:21319717-21319739 AGGTAGATGACAGTGGCTGGAGG - Intergenic
1135992264 16:27225254-27225276 AGGAAAGACACAGTGAATGGAGG + Intronic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136292753 16:29285635-29285657 AGAAAGAGCGCGGTGCCTGGGGG - Intergenic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137023790 16:35454361-35454383 AGGCAGAGCAGTGTGAGTGGGGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140109405 16:71990289-71990311 AGGAAGAGGATAGTGACATGTGG + Exonic
1140660099 16:77181083-77181105 AGGAGGAGCATGGTGACTTGGGG + Intergenic
1141112606 16:81282465-81282487 TGGAAGAGCACATAGACTTGGGG + Intronic
1141292769 16:82735382-82735404 ATGAATAGCACAGTCACTGCAGG - Intronic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1142098640 16:88259639-88259661 AGAAAGAGCGCGGTGCCTGGGGG - Intergenic
1142398955 16:89849197-89849219 AGGAAGTGGACAGTGCCTGGGGG + Intronic
1142441016 16:90097669-90097691 AGGATGGGCACTGTGGCTGGAGG - Intergenic
1142497911 17:316129-316151 AGGTGGAGCACAGGGACTGCAGG - Intronic
1142682328 17:1557426-1557448 AGACGGAGCCCAGTGACTGGAGG + Intronic
1143030747 17:3965604-3965626 AGGAAGAGCACAGAATCTGGGGG - Intergenic
1143374319 17:6458340-6458362 AAGAAGATGACAGTGACAGGAGG - Intronic
1144307046 17:13978203-13978225 AGGAAGGTTACAGAGACTGGAGG + Intergenic
1144858478 17:18284388-18284410 AGGAAGAGCAGAGGGGCTGGAGG - Intronic
1144860159 17:18296684-18296706 AAGAAGCACACAGGGACTGGTGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146554587 17:33812825-33812847 AGGAGGAGCACAGTGGCTTTGGG - Intronic
1147202227 17:38810467-38810489 AGGATGAGCACAGTGCAGGGAGG - Exonic
1148037730 17:44680722-44680744 AGGAAAAGCACACTGAATGGAGG + Intronic
1148456918 17:47816151-47816173 AGGAGGTGGACAGTGAGTGGAGG + Exonic
1148866086 17:50629402-50629424 TGGAAGAGGGCAGTGCCTGGAGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149564136 17:57629602-57629624 AGGAAGAGGGCTGTTACTGGGGG + Intronic
1150333156 17:64310730-64310752 GGGAAGAGCACAGAGACCAGAGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151688067 17:75661317-75661339 AGGAAGAGCACAGGCTTTGGAGG - Intronic
1152118859 17:78405849-78405871 CGGAAGAGCTGAGTGAGTGGGGG + Intronic
1152202515 17:78955321-78955343 AGCAAGATCCCAGTGACTGAGGG + Intergenic
1152644281 17:81461599-81461621 AGGAAGAGGACACGGACAGGCGG - Exonic
1153060920 18:994426-994448 AGGAACACCCCAGAGACTGGAGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1160327609 18:77965518-77965540 AGGAAGAGAGCACTCACTGGAGG - Intergenic
1160411257 18:78676979-78677001 AGGAACATCACAGTGAACGGAGG + Intergenic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1163492512 19:17625112-17625134 ATGAAGAGAAGAGTGAGTGGTGG + Intronic
1163791188 19:19306929-19306951 AGGAAGAGCCCTGAGTCTGGTGG + Intronic
1164686542 19:30169813-30169835 AGGATGGGGACAGTGCCTGGAGG + Intergenic
1165698483 19:37919324-37919346 AGTAAGAGCTCAGTGAATGCTGG - Intronic
1166348548 19:42182362-42182384 AGGAAGAGAACAAGGACAGGAGG + Intronic
1166571379 19:43799036-43799058 AGGAAGAACGCTGAGACTGGAGG - Intronic
1167153255 19:47722367-47722389 AGGAAGGGCCAAGTCACTGGAGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927193237 2:20531357-20531379 GGGTAGAGCACAGTGCCTGCAGG - Intergenic
928287891 2:30009132-30009154 AAGAAGAGCAGAGTGCCAGGAGG - Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928538464 2:32262235-32262257 AGGAAGGACTCAGTGAATGGCGG + Intronic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929091737 2:38224195-38224217 AGAAAAAGCACAGTTAATGGGGG + Intergenic
929600929 2:43204119-43204141 AGGAAGAGGACAGGCAGTGGGGG + Intergenic
929969411 2:46561248-46561270 AGGAAGAGTACGGTGAGGGGAGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931411935 2:62041095-62041117 AGGAAGAGCAAAGTTTCTGGTGG - Intronic
931427689 2:62185878-62185900 AGGTAGAGCCCTGTGTCTGGGGG + Intergenic
934607384 2:95707091-95707113 GGGAAGAAGACAGTGGCTGGTGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936540783 2:113349276-113349298 GGGAAAAGGACAGTGGCTGGTGG - Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937012908 2:118577548-118577570 AGGAAAAGCACAGAGCCTGAGGG - Intergenic
938122075 2:128641099-128641121 GGGAAGAGGAGAGAGACTGGTGG + Intergenic
939198210 2:138999874-138999896 AAGATGAGAACAGTGACAGGAGG + Intergenic
939372431 2:141318618-141318640 AGGAAAAGCAAAATGGCTGGAGG + Intronic
940041517 2:149366562-149366584 AAGAAGAGTCCAGGGACTGGGGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941595579 2:167472712-167472734 AGGAAGAGCACAGCAAGCGGAGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942632997 2:177972279-177972301 AGGAAGAGAACAGTGACAGAAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944613989 2:201441661-201441683 AGAAAGAGCACACTGTCTGGAGG - Intronic
944948002 2:204712802-204712824 AGGAAGATTACTATGACTGGAGG - Intronic
947099991 2:226609806-226609828 GGAAAGAGCACACTGTCTGGTGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947594358 2:231401411-231401433 AGGATCAGCACAGTGGCTGAAGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169933523 20:10858622-10858644 AGGCACAGCACAATCACTGGAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170334955 20:15259438-15259460 AGATATAGCACTGTGACTGGGGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172743713 20:37189975-37189997 AGAAAGAGCAAATTGACTAGAGG + Intronic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1175132397 20:56799255-56799277 AGCATGAGCACAGTGAGTGGAGG + Intergenic
1175549170 20:59805601-59805623 AGGAAGAGCCATGTGGCTGGGGG + Intronic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1177106998 21:16969316-16969338 AAGTTGAGGACAGTGACTGGGGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1178162437 21:29935056-29935078 AGGAAGACCTCTGTGGCTGGAGG - Intronic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1179896824 21:44367688-44367710 AGGAAGAGCAGGGTGACTCTAGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180595993 22:16973774-16973796 AGGAAGAGCACAGGGTCTGCTGG - Intronic
1181483772 22:23218091-23218113 ATGAAGAGAACAGTGAGGGGAGG - Intronic
1181529314 22:23507636-23507658 AGGAAGGGCTCTGAGACTGGGGG + Intergenic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183827043 22:40396739-40396761 AGGAGGACCAGAGTGAATGGGGG + Intronic
1184502460 22:44882378-44882400 AGGAAGGGCACAGGCTCTGGCGG + Exonic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950739018 3:15034808-15034830 AGGTAGGGCACAGGGACTTGGGG + Exonic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951263291 3:20537459-20537481 GGGAAGAGTTCAATGACTGGGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955926092 3:64006546-64006568 AGGAATAGGACAGGGAATGGAGG + Intergenic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
957042955 3:75350920-75350942 AGGAAGGGCACAGTGAACAGGGG + Intergenic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958111709 3:89156159-89156181 AGGAAGATTATAATGACTGGTGG + Intronic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958672590 3:97223539-97223561 ATGAAAAGCAGAGTCACTGGGGG + Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960639387 3:119811732-119811754 AGGAACTGCACAGTGACCCGAGG + Intronic
960744717 3:120874414-120874436 TGGAAAAGAAAAGTGACTGGTGG + Intergenic
961022292 3:123518373-123518395 AAGAAAAGCATGGTGACTGGAGG - Intronic
961538627 3:127585719-127585741 AAGAAGGGGACAGTGTCTGGTGG - Intronic
961771408 3:129252771-129252793 AGGCAGCCCACACTGACTGGTGG - Intronic
962170506 3:133096611-133096633 AGGAAAGGCACAGTGCATGGTGG - Intronic
962411239 3:135143369-135143391 AGGATGGTCACAGTGACTGCAGG + Intronic
962587001 3:136851798-136851820 AGGAAGAGCAATGTGACAGTGGG + Intronic
962812531 3:138971996-138972018 TGGCAGAGGTCAGTGACTGGAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965486979 3:169290246-169290268 GGGAAAAACACAGTAACTGGGGG + Intronic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966539802 3:181076645-181076667 AGGAAGAGAACTGTGTCTGTAGG + Intergenic
967608831 3:191481054-191481076 AGGAAGAGCACAGTGATAAAGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968361274 3:198148642-198148664 AGGATGGGCACTGTGGCTGGAGG - Intergenic
968384716 4:125630-125652 AGGAAGAGGACAGTGCCCAGCGG - Intronic
968557651 4:1255676-1255698 AGGAGGAGGGCAGTTACTGGCGG - Intergenic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
968866936 4:3219074-3219096 AAGAAGAGGCCAGTGCCTGGCGG + Intronic
968881924 4:3305345-3305367 AGCAGGTGCACAGTGACAGGTGG - Intronic
968902040 4:3436459-3436481 AGGCTGAGCAAAGTGCCTGGGGG + Intronic
969016030 4:4104920-4104942 AGGAAGAGGAATGTGTCTGGCGG + Intergenic
969544331 4:7814771-7814793 AGAAAGAGCACAGGGGCTGGGGG + Intronic
970028253 4:11647552-11647574 TGGAAGAGCTTAGGGACTGGTGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970617551 4:17781790-17781812 GGACAGGGCACAGTGACTGGCGG + Intergenic
970617560 4:17781824-17781846 GGACAGGGCACAGTGACTGGCGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972686735 4:41360103-41360125 AGTAGGTGCACAGTGACTGTTGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
978055793 4:104264375-104264397 CAGAAGAGCACAGTGAATGAGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979717727 4:123861897-123861919 AGGAAGAGCACTGATACTGGAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980091556 4:128448124-128448146 AGGAAAGGCTCAGTGAATGGTGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981061404 4:140429046-140429068 AGAAATGGCACAGGGACTGGAGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981867032 4:149434845-149434867 AGGAAGCGCCCAGTGATGGGAGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
985529394 5:424919-424941 AGGGGGACCACAGTGCCTGGAGG - Intronic
986447265 5:7832286-7832308 AGGAAGAGCACAGGGACAAACGG - Intronic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986953566 5:13121990-13122012 AAAAAGAGCACAGTGTCTGAGGG - Intergenic
987001240 5:13662209-13662231 AGGAAGAGCCCTGAGAATGGAGG + Intergenic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
987623262 5:20364069-20364091 AGGAAGAGCACATTGAAGGCAGG + Intronic
988639915 5:33030461-33030483 AGCAAGAGCACAGGTCCTGGGGG + Intergenic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
989135819 5:38153675-38153697 AGGAAGAGAGAAATGACTGGTGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992213851 5:74506696-74506718 AGATAGAGCACAGGCACTGGAGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993144682 5:84078990-84079012 AGGAAGAGGAGAGGGACTGAAGG + Intronic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993535084 5:89074235-89074257 AGATAAAGTACAGTGACTGGAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995042306 5:107602858-107602880 TAGAAGAGCACAGTGACTAGAGG + Intronic
995136004 5:108680493-108680515 AGTAAGATCAGATTGACTGGGGG + Intergenic
995195502 5:109362644-109362666 AGGAAGAGGTCACTGACTGGAGG + Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
996179187 5:120398615-120398637 AGGAAGTGCACAGTGAAGAGGGG - Intergenic
996192902 5:120567368-120567390 AGGTAAAGCACAGTGGCAGGAGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997416908 5:133736053-133736075 AGGATGTGCACAGTGCCTGGAGG + Intergenic
997762549 5:136463484-136463506 ATGCTGAGCACAGTGATTGGAGG - Intergenic
998058539 5:139100357-139100379 AGCAAGACCAGAGTGACTAGAGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999080915 5:148842923-148842945 AGAAAGAGCACTGGAACTGGGGG + Intergenic
999435385 5:151559454-151559476 AGGAAGAGCACAAGGACTAGGGG + Intronic
999887403 5:155937995-155938017 AGAAAGAGCACAGGACCTGGAGG - Intronic
1000093290 5:157948909-157948931 AGGAAGAGCATTGTGCCTGCGGG - Intergenic
1001010950 5:168097856-168097878 AGGAAGAGAATAGGGAGTGGTGG - Intronic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1002705892 5:181160712-181160734 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705901 5:181160742-181160764 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705910 5:181160772-181160794 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705919 5:181160802-181160824 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705928 5:181160832-181160854 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002706027 5:181161162-181161184 AGGACGAGCATCGTCACTGGGGG + Intergenic
1004142078 6:13027459-13027481 AGGAAGAGCACAGCTTCTGCTGG - Intronic
1004670804 6:17794772-17794794 AGTAAGTGCTCAGTGAATGGTGG - Intronic
1005018672 6:21397508-21397530 GGGCAGAACACATTGACTGGTGG - Intergenic
1005373119 6:25155368-25155390 GGGAGGAGCACTGTGACTGAAGG - Intergenic
1006418847 6:33920993-33921015 ATGAAGAGCTCAGTGAAAGGAGG + Intergenic
1006896851 6:37476680-37476702 AGGAAGAGAACAGAGTCAGGAGG + Intronic
1007099026 6:39231775-39231797 AGGAAGAGAACACAGACCGGAGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009371053 6:62904564-62904586 AGAAAGAACAAAGTGACTAGAGG + Intergenic
1009557777 6:65196697-65196719 AGTAAGAGCACAGCGAATGAAGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012180263 6:96144016-96144038 AGGAAGAGCACAGGGATTAAGGG - Intronic
1013402529 6:109812782-109812804 AGGAATAGGACAGTATCTGGAGG + Intronic
1013570344 6:111417487-111417509 AGGAACAGCACAGTGAGAGCGGG - Intronic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014293803 6:119593180-119593202 AGGAAGGGAACAATGAATGGGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015527835 6:134190610-134190632 GGGAAGAGAACAGTGACAAGGGG - Intronic
1016010352 6:139133091-139133113 AGGCAGAGAACAGAGTCTGGAGG + Intergenic
1016052252 6:139542297-139542319 CGGAAGAGCACAGTGAGCTGAGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016366599 6:143325309-143325331 AGGAAGAGTACAGGGTCTGAAGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018701802 6:166433145-166433167 AGAAGGTGCACAGTGGCTGGAGG - Intronic
1019254415 7:40079-40101 AGGATGGGCACTGTGGCTGGAGG + Intergenic
1019403098 7:867610-867632 AGGAAGTGCACGGTCACTGGAGG + Intronic
1019813584 7:3183033-3183055 ACAAAGAGCTCAGTGAATGGAGG + Intergenic
1020334888 7:7055727-7055749 AGGAAGAGCACAGAGACACCAGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023207090 7:37763138-37763160 AGGAAGAGCAGTGTGATGGGCGG + Intronic
1023539651 7:41251700-41251722 GGAAAAAGCACAGTGACTAGAGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024473503 7:49787634-49787656 AGCAAAAGCACAGCGAGTGGAGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1027304066 7:76874035-76874057 AGGAAAAGTACAGAGATTGGAGG - Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027846336 7:83381294-83381316 GTGAAGAGCAGTGTGACTGGAGG - Intronic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1027996026 7:85426530-85426552 AAAAATAGCACAGTGAATGGGGG + Intergenic
1028134488 7:87211225-87211247 AGGAAGAACAAAGTGCCTGGAGG - Intronic
1028306176 7:89268027-89268049 AGGAAGAGCAAAGTGAAATGTGG - Intronic
1028847714 7:95500860-95500882 AAGAAGAGCACAATTGCTGGAGG - Intronic
1029851969 7:103470972-103470994 AGGAAGGTCACAGTTAGTGGAGG - Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031974394 7:128084692-128084714 AGGAAGAGCACAGTGAGACCTGG - Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033229229 7:139583696-139583718 AGAAAGTGCCCAGTGACTGCAGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1036243009 8:7094705-7094727 AGGAAGAGGAATGTGTCTGGCGG - Intergenic
1036305610 8:7599524-7599546 GGGAAGGGCACAGTGAGTAGGGG - Intergenic
1036356461 8:8047521-8047543 GGGAAGGGCACAGTGAGTAGGGG - Intergenic
1036898811 8:12656726-12656748 AGGAAGAGGAATGTGTCTGGCGG + Intergenic
1037164208 8:15807233-15807255 TGGAAGAGCATAATGCCTGGGGG - Intergenic
1037787781 8:21912668-21912690 GAGAAGAGGACAGTGACTGCAGG + Intronic
1038429309 8:27486915-27486937 AAGAACAGCACAGTGACCGCAGG + Intergenic
1038559046 8:28553679-28553701 TGGAAGATCACAATGACTGTTGG - Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1040743238 8:50605543-50605565 AAGACTAGCACAGCGACTGGCGG - Intronic
1040967897 8:53102337-53102359 AGGAAGACCACAGTTCTTGGGGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1043381054 8:79702597-79702619 AGGAATAACTCTGTGACTGGAGG + Intergenic
1043432033 8:80204581-80204603 AGGAAGAGCTCAAAGACTGAAGG + Intronic
1044493327 8:92846798-92846820 AGGAAGGGTAATGTGACTGGTGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044835507 8:96291863-96291885 AGGAGGCACACAGTGTCTGGTGG + Intronic
1044836173 8:96297712-96297734 AGGTGGAGCACAGTTACTGGAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046272314 8:111913029-111913051 ATTAAGATCACAGTGACAGGAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047474966 8:125218335-125218357 TTGAATAGCACAGTGACTTGGGG - Intronic
1047970699 8:130081780-130081802 ATGAAGAGCACATTGATTTGTGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048528987 8:135230242-135230264 TGGAAGAACACACTGTCTGGAGG - Intergenic
1049353511 8:142176720-142176742 TGGAAGACCACAGGGACTGTGGG - Intergenic
1049379324 8:142304208-142304230 AGGAAGTGAGCAGTGCCTGGCGG + Intronic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049727021 8:144151771-144151793 AGGGGGAGCACAGAGACGGGAGG - Intronic
1049782491 8:144435321-144435343 AGGAATAGCAGAGGGGCTGGTGG - Intronic
1049796228 8:144498436-144498458 AGGAAGAGCTCCCTGCCTGGAGG - Intronic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051679286 9:19590862-19590884 AGAAAGAGAAAAGTGAGTGGTGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053169086 9:35865680-35865702 AGGATGAGCACAGTAGATGGGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055685306 9:78766964-78766986 AGGAAGTGCACAGGAAGTGGTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056390864 9:86140483-86140505 AGGCTGGGCACAGTGGCTGGTGG + Intergenic
1056429800 9:86516012-86516034 AGGAAGAGCCCAGTTAATTGAGG - Intergenic
1057029576 9:91765037-91765059 AGGAAGAGCACTGAGACCTGAGG - Intronic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1057765273 9:97911223-97911245 ATGAAAAGCATAGTCACTGGAGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060168610 9:121441950-121441972 AGGAGGAGCAGAGACACTGGAGG - Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060564176 9:124575043-124575065 AGGAACATCACAGTGACTCAAGG - Intronic
1060891642 9:127192994-127193016 AGTCAGAGCTGAGTGACTGGAGG + Intronic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062745985 9:138212462-138212484 AGGATGGGCACTGTGGCTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186489623 X:9961314-9961336 TGGATGAGCAGGGTGACTGGTGG + Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186886361 X:13918163-13918185 AGGAAGAGCCCACAGTCTGGTGG - Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1190875702 X:54458768-54458790 ATGATGAGCACTGTGACTAGTGG - Intronic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192602665 X:72481182-72481204 AGGAAGGGCAGAGTGAAGGGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194934484 X:99931769-99931791 AGAAAGATCAGAGTGCCTGGAGG + Intergenic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195694246 X:107655135-107655157 AGAAGGAGCACGGTGACGGGCGG + Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197971883 X:132122966-132122988 AGGAAAATGGCAGTGACTGGAGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199584881 X:149404549-149404571 AGGAAGAGAAGAGGGACAGGTGG - Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic