ID: 1187581148 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:20608733-20608755 |
| Sequence | ACTAGCAATCTCTAGGTTGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187581144_1187581148 | 23 | Left | 1187581144 | X:20608687-20608709 | CCAGAGCTTGAGCTAATAGAAAG | No data | ||
| Right | 1187581148 | X:20608733-20608755 | ACTAGCAATCTCTAGGTTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187581148 | Original CRISPR | ACTAGCAATCTCTAGGTTGT GGG | Intergenic | ||
| No off target data available for this crispr | |||||