ID: 1187581148

View in Genome Browser
Species Human (GRCh38)
Location X:20608733-20608755
Sequence ACTAGCAATCTCTAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187581144_1187581148 23 Left 1187581144 X:20608687-20608709 CCAGAGCTTGAGCTAATAGAAAG No data
Right 1187581148 X:20608733-20608755 ACTAGCAATCTCTAGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187581148 Original CRISPR ACTAGCAATCTCTAGGTTGT GGG Intergenic
No off target data available for this crispr