ID: 1187581752

View in Genome Browser
Species Human (GRCh38)
Location X:20614640-20614662
Sequence GGGATCAGGAGTGAAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187581752_1187581757 6 Left 1187581752 X:20614640-20614662 CCTGCTCCTTCACTCCTGATCCC No data
Right 1187581757 X:20614669-20614691 CACCTCCCCAGTGAGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187581752 Original CRISPR GGGATCAGGAGTGAAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr