ID: 1187583684

View in Genome Browser
Species Human (GRCh38)
Location X:20636614-20636636
Sequence ATGAAGTCAAATCTTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187583684_1187583689 27 Left 1187583684 X:20636614-20636636 CCTTCTCCAAGATTTGACTTCAT No data
Right 1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG No data
1187583684_1187583688 15 Left 1187583684 X:20636614-20636636 CCTTCTCCAAGATTTGACTTCAT No data
Right 1187583688 X:20636652-20636674 CTCTTCATATACAATTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187583684 Original CRISPR ATGAAGTCAAATCTTGGAGA AGG (reversed) Intergenic