ID: 1187583684 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:20636614-20636636 |
| Sequence | ATGAAGTCAAATCTTGGAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187583684_1187583689 | 27 | Left | 1187583684 | X:20636614-20636636 | CCTTCTCCAAGATTTGACTTCAT | No data | ||
| Right | 1187583689 | X:20636664-20636686 | AATTTATCAGGAAATCTTGTTGG | No data | ||||
| 1187583684_1187583688 | 15 | Left | 1187583684 | X:20636614-20636636 | CCTTCTCCAAGATTTGACTTCAT | No data | ||
| Right | 1187583688 | X:20636652-20636674 | CTCTTCATATACAATTTATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187583684 | Original CRISPR | ATGAAGTCAAATCTTGGAGA AGG (reversed) | Intergenic | ||