ID: 1187583687

View in Genome Browser
Species Human (GRCh38)
Location X:20636638-20636660
Sequence TATGAAGAGAAAGAGAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187583687_1187583688 -9 Left 1187583687 X:20636638-20636660 CCTCATTTCTCTTTCTCTTCATA No data
Right 1187583688 X:20636652-20636674 CTCTTCATATACAATTTATCAGG No data
1187583687_1187583689 3 Left 1187583687 X:20636638-20636660 CCTCATTTCTCTTTCTCTTCATA No data
Right 1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG No data
1187583687_1187583690 27 Left 1187583687 X:20636638-20636660 CCTCATTTCTCTTTCTCTTCATA No data
Right 1187583690 X:20636688-20636710 TCTACTTTCAAAATATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187583687 Original CRISPR TATGAAGAGAAAGAGAAATG AGG (reversed) Intergenic