ID: 1187583689

View in Genome Browser
Species Human (GRCh38)
Location X:20636664-20636686
Sequence AATTTATCAGGAAATCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187583687_1187583689 3 Left 1187583687 X:20636638-20636660 CCTCATTTCTCTTTCTCTTCATA No data
Right 1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG No data
1187583686_1187583689 4 Left 1187583686 X:20636637-20636659 CCCTCATTTCTCTTTCTCTTCAT No data
Right 1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG No data
1187583684_1187583689 27 Left 1187583684 X:20636614-20636636 CCTTCTCCAAGATTTGACTTCAT No data
Right 1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG No data
1187583685_1187583689 21 Left 1187583685 X:20636620-20636642 CCAAGATTTGACTTCATCCCTCA No data
Right 1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187583689 Original CRISPR AATTTATCAGGAAATCTTGT TGG Intergenic