ID: 1187588462

View in Genome Browser
Species Human (GRCh38)
Location X:20689874-20689896
Sequence GGACCTGCCCTGGGAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187588462_1187588468 1 Left 1187588462 X:20689874-20689896 CCCCTCTTTCCCAGGGCAGGTCC No data
Right 1187588468 X:20689898-20689920 GAAATGCCGTCCAAGAGCCTAGG No data
1187588462_1187588469 6 Left 1187588462 X:20689874-20689896 CCCCTCTTTCCCAGGGCAGGTCC No data
Right 1187588469 X:20689903-20689925 GCCGTCCAAGAGCCTAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187588462 Original CRISPR GGACCTGCCCTGGGAAAGAG GGG (reversed) Intergenic
No off target data available for this crispr