ID: 1187595632

View in Genome Browser
Species Human (GRCh38)
Location X:20769509-20769531
Sequence ATATGTATTCTGCAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187595632_1187595636 24 Left 1187595632 X:20769509-20769531 CCCCCAAACTGCAGAATACATAT No data
Right 1187595636 X:20769556-20769578 ACCAAAATAGACCATATGCCAGG 0: 2
1: 6
2: 37
3: 259
4: 1309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187595632 Original CRISPR ATATGTATTCTGCAGTTTGG GGG (reversed) Intergenic
No off target data available for this crispr