ID: 1187595636

View in Genome Browser
Species Human (GRCh38)
Location X:20769556-20769578
Sequence ACCAAAATAGACCATATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1613
Summary {0: 2, 1: 6, 2: 37, 3: 259, 4: 1309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187595632_1187595636 24 Left 1187595632 X:20769509-20769531 CCCCCAAACTGCAGAATACATAT No data
Right 1187595636 X:20769556-20769578 ACCAAAATAGACCATATGCCAGG 0: 2
1: 6
2: 37
3: 259
4: 1309
1187595633_1187595636 23 Left 1187595633 X:20769510-20769532 CCCCAAACTGCAGAATACATATT No data
Right 1187595636 X:20769556-20769578 ACCAAAATAGACCATATGCCAGG 0: 2
1: 6
2: 37
3: 259
4: 1309
1187595634_1187595636 22 Left 1187595634 X:20769511-20769533 CCCAAACTGCAGAATACATATTC No data
Right 1187595636 X:20769556-20769578 ACCAAAATAGACCATATGCCAGG 0: 2
1: 6
2: 37
3: 259
4: 1309
1187595635_1187595636 21 Left 1187595635 X:20769512-20769534 CCAAACTGCAGAATACATATTCT No data
Right 1187595636 X:20769556-20769578 ACCAAAATAGACCATATGCCAGG 0: 2
1: 6
2: 37
3: 259
4: 1309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187595636 Original CRISPR ACCAAAATAGACCATATGCC AGG Intergenic
900153359 1:1191505-1191527 TCCAGGATAGACCATATGCTGGG - Intronic
900969558 1:5982929-5982951 ACCAAGATAGACCGTATGCTGGG - Intronic
902544349 1:17179011-17179033 ACCAAAATTGACCACATCCTTGG + Intergenic
903752359 1:25633208-25633230 TCCAAGATAGACCATATGATAGG - Intronic
903752755 1:25637466-25637488 GCCAATATAGACCATATAGCTGG - Intronic
904331800 1:29763056-29763078 ACCAACATAGACCATGTGCTGGG + Intergenic
904346317 1:29872846-29872868 ACCAATATAGACCATATCCTGGG + Intergenic
904582446 1:31555586-31555608 ACAAAAATTGACCCTATGCTGGG - Intergenic
905052578 1:35064529-35064551 ACCGAAATAGACAATATCCTGGG + Intronic
905834295 1:41104029-41104051 ACCAAAATAGAGCACTTTCCTGG + Intronic
905963975 1:42073932-42073954 ACCAAGATAGACCACATTCTGGG - Intergenic
905987387 1:42299058-42299080 TCCAAAATTGACCATATGCTTGG - Intronic
906092396 1:43192150-43192172 TCCAGAATAGATTATATGCCAGG - Intronic
906446894 1:45908691-45908713 ACCAAGAAAGACCACATGCTAGG - Intronic
906504400 1:46367394-46367416 AACAAAAAAGAGCATATCCCAGG - Intergenic
906563774 1:46781351-46781373 TCCAAGATAGACCATATGATAGG - Intronic
906868019 1:49444173-49444195 TCCAAAATAGACCATATGTTAGG - Intronic
906914873 1:49997782-49997804 TCCAAGATAGACCATATGATAGG + Intronic
907209379 1:52806178-52806200 ACCAAAATAGACCATATCCTTGG - Intronic
907349383 1:53813853-53813875 TCCAAGATAGACCATATGATAGG + Intronic
908174870 1:61545405-61545427 TCCAAGATAGACCATATGATAGG - Intergenic
908660460 1:66429616-66429638 TCCAAGATAGACCATATGGTAGG - Intergenic
908694991 1:66829793-66829815 ACCAATATAGACCACATACTGGG + Intronic
908697189 1:66856567-66856589 ACCAAGATAGACTATATTCTGGG + Intronic
908716022 1:67069973-67069995 AACAAAATAGAAAATAGGCCAGG - Intergenic
908744718 1:67364885-67364907 ACCAAGATACACCATATTCTGGG + Intronic
908862163 1:68501341-68501363 TCCAAGATAGACCATATGATAGG + Intergenic
908883092 1:68755422-68755444 ACCCACATAGACCATATTCTTGG + Intergenic
909211149 1:72825795-72825817 TCCAAAATAGACCATACTCTGGG + Intergenic
909227856 1:73047990-73048012 TCCAAGACAGACCATATGACAGG + Intergenic
909235036 1:73142054-73142076 TCCAAGATAGACCATATGATAGG - Intergenic
909248695 1:73324780-73324802 TCCAAAATAGACAATATGCTTGG - Intergenic
909321588 1:74295276-74295298 GCCAAAATCCACCATATGCTTGG - Intronic
909368046 1:74851293-74851315 ACCAAGATACACCATATTCTGGG - Intergenic
909495833 1:76277795-76277817 ACCAAATTTCCCCATATGCCTGG + Intronic
909511134 1:76453692-76453714 TCCAAGATAGACCATATGACAGG - Intronic
909733939 1:78932660-78932682 AACAAAATAGACCACAAGCTAGG + Intronic
909830482 1:80183063-80183085 TCCAAGATAGACCATATGATAGG - Intergenic
909861735 1:80614633-80614655 TCCAAAATTGATCATATGCTTGG - Intergenic
909948126 1:81687047-81687069 TCCAAGATAGACCATATGATAGG - Intronic
909981158 1:82102979-82103001 TCCAAGATAGACCATATGATAGG - Intergenic
910016194 1:82527448-82527470 TCCAAGATAGACCATATGATAGG - Intergenic
910150371 1:84135506-84135528 ACCAAGATAGACCACATTCTTGG + Intronic
910249010 1:85174404-85174426 ACCACAAAAGACCATATTCTGGG + Intronic
910315832 1:85882527-85882549 ACCAAGATAGACCAAATTCTGGG - Intronic
910644033 1:89493693-89493715 TCCAAAATTGACCATATACTTGG + Intergenic
910774698 1:90863185-90863207 ACCAAGATAGACTATATGTTGGG + Intergenic
910889766 1:92006141-92006163 ACCAAAGTAGACCATAAGCCAGG - Intronic
910977844 1:92926424-92926446 ACCAAGATAGACCATATCCAGGG - Intronic
911065878 1:93787726-93787748 TCCAAGATAGACCATATGATAGG - Intronic
911080945 1:93929954-93929976 TCCAAGATAGACTATATGACAGG + Intergenic
911280296 1:95917688-95917710 ACCAACATAGAGCATATGCTGGG + Intergenic
911318087 1:96378874-96378896 TCCAAGATAGACCATATGATAGG + Intergenic
911493148 1:98594418-98594440 ACCAAGATAGGCCATATTCTGGG - Intergenic
911743490 1:101413317-101413339 TCCAAGATAGACCATATGATAGG + Intergenic
911838136 1:102647094-102647116 ACCAAAATTGACCATATTCTGGG + Intergenic
912976238 1:114333020-114333042 ACCCATATAGCCCATATGCTGGG - Intergenic
913028270 1:114869445-114869467 ATCAAGATAGACCATATTCTGGG - Intronic
913143360 1:115964159-115964181 TCCAAGATAGACCATATGATAGG + Intergenic
913236406 1:116787659-116787681 TCCAAGATAGACCATATGGAAGG + Intergenic
913403215 1:118459316-118459338 CCCAATAAAGACCATATGCTGGG - Intergenic
913417952 1:118633150-118633172 TCCAAGATAGACCATATGATAGG - Intergenic
913455195 1:119023207-119023229 TCCAAAATTGACCACATGCTTGG + Intergenic
913972831 1:143428281-143428303 TCCAAGATAGACCATATGATAGG - Intergenic
914067214 1:144253889-144253911 TCCAAGATAGACCATATGATAGG - Intergenic
914111939 1:144712465-144712487 TCCAAGATAGACCATATGATAGG + Intergenic
914346296 1:146801727-146801749 TCCAAGATAGACCATATGATAGG + Intergenic
915078471 1:153332606-153332628 TCAAAAATAGACCATATGCTAGG + Intronic
915688154 1:157657879-157657901 ACCAAGAGAGACCATATGCCAGG + Intergenic
915750759 1:158207780-158207802 TCCAGAATAGATTATATGCCAGG - Intergenic
915858774 1:159419740-159419762 TCCAAAATAGATCATATGTTAGG - Intergenic
916305916 1:163332390-163332412 ACAAATATAGACCATATTCTGGG - Intronic
916387485 1:164291447-164291469 ACCAAAATTGATTATATGCTGGG + Intergenic
916805648 1:168258157-168258179 ACCAACACAGACCATATTCTGGG - Intergenic
916868946 1:168891174-168891196 TCCAAGATAAACCATATGACAGG + Intergenic
916872935 1:168937243-168937265 TCCAAGATAGACCATATGGTAGG - Intergenic
916903013 1:169250888-169250910 TCCACAATAGACCATATGCTAGG - Intronic
917093379 1:171376141-171376163 ACCAAAATTGACCACATACTTGG + Intergenic
917221206 1:172730639-172730661 TCCAAAACTGACCATATGCTTGG + Intergenic
918172127 1:182007946-182007968 TCCAAAATAGACCACATGATAGG + Intergenic
918189581 1:182160995-182161017 TCCAAGATAGACCATATGTTAGG - Intergenic
918398189 1:184137172-184137194 TCCAGAATAGACCATATGCTAGG - Intergenic
918471084 1:184874907-184874929 ATAAAAATTGACCATATGCAGGG + Intronic
918485533 1:185025197-185025219 ACCAAGATAGGCCATATTCCAGG + Intergenic
918750572 1:188264427-188264449 TCCAAAATAAACCATATGAAAGG - Intergenic
918873704 1:190010621-190010643 TCCAAGATAGACCATATGATAGG + Intergenic
919115278 1:193273878-193273900 TCCAAGATAGACCATATGATAGG - Intergenic
919370625 1:196721469-196721491 TCCAAAATAGACCATATGCTAGG - Intronic
919421001 1:197370404-197370426 TCCAAGATAGACCATATGATAGG + Intronic
919492034 1:198216158-198216180 TCCAAGATAGACCATATGATAGG + Intronic
919549258 1:198964285-198964307 TCCAAGATAGACCATATGATAGG - Intergenic
920545919 1:206818246-206818268 ACCAAGACAGACCATATTCTGGG + Intronic
920601937 1:207335346-207335368 ACCAAAATTGACCCTTTGCTGGG + Intronic
920618332 1:207518302-207518324 ACCAAAATCGTCCATATTCTGGG - Intronic
920722935 1:208404876-208404898 AGCAAGATAGACCATATCCTGGG + Intergenic
920883886 1:209907056-209907078 TCCAGAATAGAACATATGCTAGG - Intergenic
920990048 1:210928292-210928314 TCCAAGATAGACCATATGATAGG + Intronic
921000987 1:211042695-211042717 TCCAAGATAGACCATATGATAGG + Intronic
921191948 1:212717862-212717884 ACCAAAATAGACTATATCCTGGG - Intergenic
921571738 1:216787731-216787753 ACCAAGATAGGCCATAAGCTAGG + Intronic
921690426 1:218142428-218142450 TCCAAGATAGACCATATGATAGG + Intergenic
921796870 1:219355697-219355719 ACCAAGATAGACCATATGGAAGG + Intergenic
921843112 1:219849563-219849585 TCCAAGATAGACCATATGATAGG + Intronic
921845231 1:219872086-219872108 ATCAAGATAAACCATATGCTGGG - Intronic
922094084 1:222426801-222426823 TCTAAAATAGACCATATGATAGG + Intergenic
922114081 1:222592661-222592683 ACCAAGATAGACTATATTCTGGG - Intergenic
922377467 1:224982866-224982888 TCCAAGATAGACCATATGATAGG - Intronic
922434022 1:225585459-225585481 ACCAAGATAGATGATATGCTGGG + Intronic
922673155 1:227530084-227530106 TCCAAGATAGACCATATGATAGG - Intergenic
922842786 1:228657753-228657775 TCCAGTATAGACCATATGTCAGG + Intergenic
922865298 1:228855666-228855688 TCCACAATATACCATATGCAAGG - Intergenic
923239867 1:232072882-232072904 TCCAAGATAGACCATATGATAGG - Intergenic
923347494 1:233069436-233069458 ACCAAGATAGACCATTTTTCTGG + Intronic
923351937 1:233116351-233116373 ACAAAGATAGACCATATTCTAGG + Intronic
923648472 1:235848108-235848130 TCCAAGATAGATCATATGACAGG + Intronic
923691711 1:236200264-236200286 TCCAAGATAGACCATATGATAGG - Intronic
923808431 1:237286434-237286456 TCCAAGATAGACCATATGATAGG - Intronic
923888375 1:238182912-238182934 TCCAGACTAGACCATATGCTAGG - Intergenic
924021034 1:239783017-239783039 ACCAAAATAGACCACATTCTGGG - Intronic
924131887 1:240918328-240918350 ACCAAGATAGACCACATTCTAGG + Intronic
924321178 1:242852561-242852583 TCCAAGATAGACCATATGATAGG - Intergenic
924358271 1:243207611-243207633 ACCAAGATAGAACATATTCTGGG + Intronic
924491014 1:244537767-244537789 ACCAAGATGCACCATATGCTGGG - Intronic
924698879 1:246429703-246429725 AGCAATATCCACCATATGCCAGG + Intronic
924885172 1:248207721-248207743 TCCAAGATAGACCATATGATAGG - Intergenic
924930123 1:248723400-248723422 TCCAAAATAGACCATATGATAGG + Intronic
1062761028 10:19522-19544 TCCAAGATAGACCATATGATAGG + Intergenic
1062900837 10:1144876-1144898 AACAAAATAGAACATATCCTGGG - Intergenic
1063976342 10:11419511-11419533 ACCAAGACAGACCATATTCTGGG + Intergenic
1064497244 10:15924849-15924871 TCCAAAATAGAGCATGTGTCAGG - Intergenic
1064556990 10:16557137-16557159 TCCAAGATAGACCATATGATAGG - Intergenic
1064925969 10:20569455-20569477 TCCAAAATAGACCACATACTTGG + Intergenic
1064975860 10:21114337-21114359 ACCAAGATAGACCATATTTTGGG - Intronic
1065084630 10:22162530-22162552 ACAAAAACAGACCCTATGCTAGG + Intergenic
1065085332 10:22169120-22169142 TCCAGAATAGACCATATGTTAGG + Intergenic
1065422317 10:25558904-25558926 ACCAAGATAGACCATATTCTGGG - Intronic
1065470722 10:26078925-26078947 TCCAAGATAGACCATATGATAGG - Intronic
1065571583 10:27075827-27075849 TCCAAGATAGACCATATGATAGG + Intronic
1065592341 10:27277387-27277409 ACCAAAATAGCCCATATTCTGGG - Intergenic
1065658011 10:27972981-27973003 ACCAAAATAGATCATATACTGGG + Intronic
1065894356 10:30149771-30149793 TCCAAGGTAGACCATATGACAGG - Intergenic
1065989749 10:30996775-30996797 TCCAAAAGAGACCACATGCTAGG + Intronic
1066170574 10:32839729-32839751 TCCAAGATAGACCATATGACAGG + Intronic
1066247914 10:33602140-33602162 TCCAAAATAGAACATATGTTAGG + Intergenic
1066511374 10:36100923-36100945 ACCAAGATAGACCACATTCTGGG + Intergenic
1066747311 10:38614011-38614033 TCCAAGATAGACCATATGATAGG + Intergenic
1067138951 10:43639691-43639713 ACCAAAACAGACCATATGCTGGG - Intergenic
1067154643 10:43767776-43767798 ACCAAGAAAGACCATATTCTGGG - Intergenic
1067430814 10:46243412-46243434 TCCAAGATAGACCATATGTCAGG + Intergenic
1067548147 10:47211388-47211410 ACCAAAATAGGCCAAATGTTAGG + Intergenic
1067762791 10:49061295-49061317 ATCAAAATAGACCATATCCTGGG - Intronic
1067798830 10:49342607-49342629 ACCAAGATAGGCCATATTCTGGG + Intergenic
1068497416 10:57801837-57801859 ACCAAAGTAGACCATATTCTGGG - Intergenic
1068906535 10:62331240-62331262 TCCAAAATAGACCATATGTTAGG - Intergenic
1069123078 10:64593231-64593253 ATCAAGATAGACCATATGTTGGG + Intergenic
1069150282 10:64951651-64951673 TCCAAGATAGACCATATGATAGG - Intergenic
1069272711 10:66549880-66549902 ACCAAATTAGATCCTATGCCAGG - Intronic
1069514093 10:69063947-69063969 GACAAAATAGACAATATTCCAGG - Intergenic
1069588364 10:69626005-69626027 ATCAAGATAGACCATATCCTGGG + Intergenic
1069648395 10:70022263-70022285 TCCAAGATAGACCATATGATGGG + Intergenic
1070374903 10:75820232-75820254 TCAAAAATTGACCATATGCTAGG + Intronic
1070465127 10:76714058-76714080 TTCAAAATAGACCATATGAGAGG + Intergenic
1070858144 10:79625541-79625563 ATAAAAATAGAGCATATGCTGGG - Intergenic
1071019720 10:81038096-81038118 ACCAAGATAGAACATATCCTTGG + Intergenic
1071035811 10:81243817-81243839 ACTGAGATAGACCACATGCCAGG + Intergenic
1071420891 10:85497689-85497711 ACCAACATTGACCACATGCTGGG - Intergenic
1071556258 10:86604394-86604416 ACAAAAATTGACCATATGCTGGG - Intergenic
1071812103 10:89193995-89194017 TCCAAGATAGACCATATGATAGG - Intergenic
1071880733 10:89895198-89895220 TCCAAGATAGACCATATGATAGG - Intergenic
1071924085 10:90385458-90385480 TCCAAAACAGACCATATGTAAGG - Intergenic
1072386260 10:94931984-94932006 ACCAATATAGACCACATTCTGGG + Intergenic
1072405688 10:95150088-95150110 ACCAAAATTGACCACATACTTGG + Intergenic
1072769041 10:98121713-98121735 TCCAAGATAGACCATATGATAGG - Intergenic
1072815136 10:98500250-98500272 TCCAAGATAGAACATATGACAGG + Intronic
1072840236 10:98765236-98765258 ACCAAGACAGACCATATTCTGGG + Intronic
1073228827 10:101948818-101948840 ACCAAGATAGACCATACTCTGGG + Intronic
1073380743 10:103076323-103076345 AGCAAAACAGACAATTTGCCAGG - Intronic
1073481322 10:103787814-103787836 ACCTAAATGGACCACATTCCTGG + Intronic
1073896187 10:108161732-108161754 ACCAAGACAGACCATATGCCAGG + Intergenic
1074635513 10:115311527-115311549 TCCAAGATAGACCATATGACAGG - Intronic
1074907943 10:117881447-117881469 ATCAAAATGGACCATCTGTCTGG - Intergenic
1074985590 10:118656474-118656496 TCCAAGATAGACCATATGATAGG - Intergenic
1074985995 10:118660008-118660030 TCCAAGATAGACCATATGATAGG - Intergenic
1075224661 10:120616969-120616991 GCCAAGATAGACTATATGCTGGG + Intergenic
1075833567 10:125432273-125432295 ATTAAAATAAACCATATGCTGGG + Intergenic
1075860983 10:125676028-125676050 TCCAGGATAGACCATATGTCAGG - Intronic
1075947032 10:126442737-126442759 TCCATGATAGACCATATGACAGG + Intronic
1075988568 10:126811751-126811773 ATGAAAATAGACCATATGGTGGG + Intergenic
1076097264 10:127741683-127741705 TCCAAAACAGCCCACATGCCTGG + Intergenic
1076308402 10:129482334-129482356 ACCAAGGTAGACCATATTCTGGG - Intronic
1076620546 10:131784698-131784720 AATAAAATAGACCTTGTGCCTGG + Intergenic
1076663539 10:132071322-132071344 ATCAAAATAGACTATTTGCTGGG - Intergenic
1076665363 10:132086274-132086296 TCCAAGATAGACCATATGATAGG - Intergenic
1077203129 11:1323615-1323637 ACTAAGATAGACCATATTCTGGG + Intergenic
1077276156 11:1709823-1709845 ACCAACATAGACCATATTCTGGG + Intergenic
1077854952 11:6115336-6115358 TCCAAGGTAGACCATATGCTAGG + Intergenic
1077908214 11:6551076-6551098 ACCAAGATAGACCATATGCTGGG + Intronic
1077937902 11:6809664-6809686 TCCACAATAGGCCATATGCTTGG - Intergenic
1077990245 11:7402233-7402255 ACCAAGATAAACCATATTCTTGG - Intronic
1078706810 11:13751729-13751751 TCCAAGATAGACCATATGGTAGG + Intergenic
1078842225 11:15089104-15089126 TCCAATATAGACCATATGATAGG - Intergenic
1078960087 11:16255337-16255359 ACCAAAACAGACCACATTCTGGG + Intronic
1078991417 11:16650355-16650377 TCCAAGATAGACCAAATGACAGG + Intronic
1079255731 11:18827818-18827840 TCCAAGATAGACCATATGATAGG - Intergenic
1079523773 11:21360403-21360425 TCTAAAATAGACCATATGATAGG - Intronic
1079558243 11:21788753-21788775 TCAAAAATAGACCATATGTTAGG - Intergenic
1079774003 11:24500273-24500295 AGCAGGAGAGACCATATGCCAGG - Intronic
1079791450 11:24745123-24745145 TCCAAGATAGACCATATGACAGG - Intronic
1079805808 11:24929633-24929655 TCCAAGATAGACCATATGACGGG - Intronic
1080324352 11:31052579-31052601 ACCAGGATAGACCATATGATAGG + Intronic
1080402528 11:31949599-31949621 TCCAAGATAGACCATATGATAGG + Intronic
1080585648 11:33680261-33680283 TCCAAGATAGACCATATGATAGG - Intergenic
1080672314 11:34392466-34392488 TCCAAGATAGACCATATGATAGG - Intergenic
1080690231 11:34550104-34550126 ACCAAGATAGACCATAGCCTAGG - Intergenic
1080830149 11:35885462-35885484 ACCAAAATAGACCATAAATTGGG - Intergenic
1080933142 11:36834764-36834786 TCTAAAATCGACCATATGCTTGG - Intergenic
1081020666 11:37944494-37944516 TCCAAAATTGACCATATGGTTGG - Intergenic
1081050538 11:38334838-38334860 TCCAAGATAGACCATATGATAGG + Intergenic
1081064710 11:38526513-38526535 TCCAAGATAGACCATATGATAGG + Intergenic
1081090857 11:38864832-38864854 TCCAAGATAGACCATATGATAGG - Intergenic
1081091940 11:38881459-38881481 AGAAAAATAGACCATATGGATGG - Intergenic
1081123724 11:39297119-39297141 ACCAAAATATCCCAGATCCCAGG + Intergenic
1082111629 11:48282927-48282949 TCCAATATAGACCATATGATAGG - Intergenic
1082120652 11:48376175-48376197 TCCAAGATAGACCATATGACAGG - Intergenic
1082171792 11:49013662-49013684 TCCAAAATAAACCAAATGCTAGG - Intergenic
1082253172 11:50004464-50004486 TCCAAGATAGACCATATGATAGG + Intergenic
1082903320 11:58280231-58280253 AACAAAATAGACCACTAGCCAGG - Intergenic
1084469641 11:69350100-69350122 ACCAAGAAAGACCATATGCTGGG - Intronic
1084993531 11:72952618-72952640 ACCAAAATTAACTATAGGCCAGG - Intronic
1085771141 11:79326855-79326877 ACCAAAATGCTCCATATGCCTGG - Intronic
1086000022 11:81972103-81972125 ACTAAAAGAGATCATATGCAGGG - Intergenic
1086007201 11:82050773-82050795 TCAAAAATAGACCATATGCTAGG + Intergenic
1086784942 11:90956984-90957006 GCCAAAATAGACCAAATTCTAGG + Intergenic
1086833116 11:91590363-91590385 TCTAAGATAGACCATATGCCAGG - Intergenic
1086974601 11:93117593-93117615 GCCAAAATTGAGCATGTGCCTGG - Intergenic
1087054983 11:93925674-93925696 ACCAAGATAGACCACATTCTGGG + Intergenic
1087096276 11:94321952-94321974 ACCAATACAGACCATATTCTGGG + Intergenic
1087351900 11:97043548-97043570 TCCAAAATTGACCACATACCTGG - Intergenic
1087395510 11:97591750-97591772 TCCAAGATAGACCATATGATAGG + Intergenic
1087469097 11:98548262-98548284 TCCAAGATAGACCATATGATAGG + Intergenic
1087690298 11:101313461-101313483 TCCAAGATAGACCATATGTTAGG - Intergenic
1087703496 11:101463714-101463736 AACAAAATAGACCACTAGCCAGG - Intronic
1087865989 11:103227596-103227618 TCCAAAATAGACCATATGACAGG - Intronic
1087992401 11:104761018-104761040 TCCAGAATAGACCATATGTTAGG + Intergenic
1088056104 11:105580914-105580936 ATCAAAATAGACTTTATGCTGGG + Intergenic
1088179737 11:107095343-107095365 TCCAAGATAGACCATATGATAGG + Intergenic
1088387826 11:109279374-109279396 TCCAAGATAGACCATATGATAGG - Intergenic
1088413292 11:109560536-109560558 TCCAAAATAGACCTTATGATAGG - Intergenic
1088580758 11:111313787-111313809 TCCAAGATAGACCATATGATAGG + Intergenic
1088957877 11:114628245-114628267 TCCAAAATTGACCATATACTTGG + Intergenic
1088958569 11:114636879-114636901 TCCAAAATTGACCATATACTTGG - Intergenic
1089086595 11:115824435-115824457 ATCAAAATAGATCATATTCTGGG - Intergenic
1089371776 11:117965532-117965554 ACGAAAATGAACCATATGTCGGG + Intergenic
1089687308 11:120162744-120162766 ACCAAGATGGATCATATGCTGGG - Intronic
1089900326 11:121976015-121976037 TCCAAGATAGACCATATGATGGG + Intergenic
1089952667 11:122544378-122544400 TCCAATATAGACCATATGATAGG - Intergenic
1090559262 11:127912918-127912940 TCCAAGATAGACCATATGATAGG - Intergenic
1090816273 11:130299180-130299202 ACCAAGAAAGATCATATGCTGGG + Intronic
1091438123 12:489840-489862 ACCAAGATTGACCATATTCGGGG + Intronic
1091697489 12:2637785-2637807 TTCCAAATAGACCATATCCCTGG - Intronic
1091859698 12:3769261-3769283 AACAAGATAGACCACATTCCAGG + Intergenic
1091861052 12:3783828-3783850 GCCGAGATAGACCATATACCAGG - Intergenic
1091927358 12:4365394-4365416 ATCAAAACAGATCATATGCTTGG - Intergenic
1092044460 12:5420241-5420263 ACCAAGATAGACCATATGCTGGG - Intergenic
1092313593 12:7385586-7385608 TCCAGAATAGACCATATTCAAGG + Intronic
1093105172 12:15077602-15077624 TCCAAGATAGACCATATGATAGG + Intergenic
1093343115 12:18003628-18003650 ACCAAGATAGACCACATCCTGGG + Intergenic
1093389825 12:18604621-18604643 TCCAAGATAGACCATATGACAGG + Intronic
1093408986 12:18842654-18842676 TCCAAGATAGACCATATGATAGG - Intergenic
1093468767 12:19478883-19478905 ACCAAGATAGACCATATGATAGG - Intronic
1093488481 12:19679059-19679081 TCCAAGATAGACCATATGATAGG - Intronic
1093598076 12:20985971-20985993 TCCAAGATAGACCATATGATAGG - Intergenic
1093604289 12:21071443-21071465 TCCAAGATAGACCATATGATAGG - Intronic
1093608418 12:21123656-21123678 TCCAAAATAGACAATATGATAGG + Intronic
1094054425 12:26255005-26255027 ACCATAATAGGCCATATGCTTGG + Intronic
1094242150 12:28241267-28241289 ACCAGAATAAACCATATCCTTGG + Intronic
1094263220 12:28525514-28525536 TCCAAGATAGACCATATGACAGG - Intronic
1094447134 12:30543919-30543941 TCCAAGATAGACCATATGCTAGG - Intergenic
1094501545 12:31025613-31025635 TCCAAGATAGACCATATGATAGG + Intergenic
1094721796 12:33073095-33073117 TCCAAGATAGACCATATGATAGG - Intergenic
1094821040 12:34225059-34225081 TCCAGAATAGACCATATGTTAGG - Intergenic
1095226028 12:39677667-39677689 TCCAAGATAGACCATATGATAGG + Intronic
1095510332 12:42944271-42944293 TCCAAAATAGACCAAATTCTGGG - Intergenic
1095532497 12:43205676-43205698 ATCAAGATAGACCACATGCTAGG + Intergenic
1095570467 12:43678407-43678429 TCCAAAATTGACCATATGCTTGG + Intergenic
1095732979 12:45525185-45525207 CCCAAGATAGACCATATGATAGG + Intergenic
1095897546 12:47295240-47295262 AACAAGATAGACCATATCCTAGG - Intergenic
1096051976 12:48617774-48617796 ACCAAAATAGACCATATGCTGGG - Intergenic
1096435286 12:51585484-51585506 ACCAAGATAGATCATATTCTGGG + Intergenic
1097209826 12:57358690-57358712 ACTAAAATAGACCATATCTTGGG - Intronic
1097299170 12:57998989-57999011 ACCAAGATAGACCATATGTTAGG - Intergenic
1097603803 12:61728138-61728160 TCCAAGATAGACCATATGATAGG - Intronic
1097651903 12:62308722-62308744 AGCAAAATTGACCATATTCTGGG + Intronic
1097659983 12:62419244-62419266 TCCAAGATAGACCATATGATAGG + Intergenic
1097742785 12:63263997-63264019 ACCAAAATACATCATATTCTAGG + Intergenic
1097759300 12:63442869-63442891 ACCAAAACAGACTATATGCTGGG + Intergenic
1098215935 12:68219258-68219280 ACCAAAATAGACCAAATTCTGGG + Intronic
1098223590 12:68297591-68297613 ACAAAAATAGTTAATATGCCAGG + Intronic
1098380015 12:69859256-69859278 ACCAAGATAGATCATATTCTGGG - Intronic
1098406761 12:70134681-70134703 TCCAAAATAGAACATATGTTAGG + Intergenic
1098752425 12:74312047-74312069 CCCAAAATACACCATATGCTTGG + Intergenic
1098836979 12:75435401-75435423 TCTAAAATAGACCATATACTTGG - Intergenic
1098852467 12:75613335-75613357 TCCAAGATAGACCATATGATAGG + Intergenic
1099163926 12:79278239-79278261 TCCAAGATAGACCATATGACAGG + Intronic
1099382567 12:81973106-81973128 TCCAAGATAGACCATATGATAGG + Intergenic
1099423883 12:82499495-82499517 ACCAAAGAAGAGAATATGCCAGG + Intergenic
1099472821 12:83072417-83072439 TCCAAAACAGACCATATGATAGG - Intronic
1099565258 12:84234874-84234896 ACCAAAATATACCATATTTTAGG - Intergenic
1099677035 12:85774034-85774056 AACAAAACAGACAATATCCCTGG - Intergenic
1099777197 12:87149056-87149078 TCCAAGATAGACCATATGATAGG - Intergenic
1099815487 12:87641491-87641513 ACAAAGATAGACCATATGCTTGG - Intergenic
1100290762 12:93212658-93212680 TCCAAGATAGACCATATGATAGG - Intergenic
1100566737 12:95802101-95802123 ACCATGATAGGCCATATGCTGGG - Intergenic
1100918764 12:99458002-99458024 TCCAAGATAGACCATATGATAGG + Intronic
1100920806 12:99484407-99484429 TTCAAGATAGACCATATGACAGG - Intronic
1101127848 12:101656926-101656948 ACCAAAATAGAACACATTCTAGG + Intronic
1101263199 12:103055952-103055974 ACCAAAATAGACTATATCATGGG - Intergenic
1101374870 12:104162862-104162884 ACCAAGATAGAGCATATTCTGGG - Intergenic
1101644505 12:106617645-106617667 ACCAAAATAGACTATATGTTGGG - Intronic
1101644552 12:106618046-106618068 ACCAAAATAGACTATATGTTGGG - Intronic
1101657857 12:106739669-106739691 ACCAAAATTGGCCATATATCAGG - Intronic
1101710987 12:107266042-107266064 ACCAAAATTGACCATGTACTGGG + Intergenic
1102065846 12:109974678-109974700 ACCCAGATAGACCATATCCTGGG - Intronic
1102090290 12:110181524-110181546 ACCAAAACAGACCGTATGCTGGG - Intronic
1103457545 12:121077866-121077888 CCCAAAATAGACCATATGATAGG + Intergenic
1103569593 12:121836042-121836064 ACCAAAGTAGAAAATATGACAGG - Intergenic
1104524381 12:129505127-129505149 TCCAAGATAGACCATATGATAGG - Intronic
1104863160 12:131935826-131935848 ACAAAAATAAACAATAGGCCGGG - Intronic
1105063514 12:133175997-133176019 TCCAAGATAGACCATATGTTAGG + Intronic
1105321433 13:19326176-19326198 TCCAAGATAGACCATATGTTAGG + Intergenic
1105662205 13:22509331-22509353 ACCAAGGTGGACCATATGCAGGG + Intergenic
1105763868 13:23538849-23538871 ACCAAAAAAGACTATGTGCTGGG - Intergenic
1105993349 13:25645829-25645851 ACCAAGACAGATCATATGACAGG - Intronic
1106325750 13:28687511-28687533 TCCAAGATAGACCATATAACAGG - Intergenic
1106767569 13:32929935-32929957 ATCAAGATAGACTATATACCAGG - Intergenic
1106828552 13:33552363-33552385 TCCAAAATAGACCATATTCTAGG + Intergenic
1106894401 13:34282768-34282790 ACCAAGATAGACCATATGATAGG - Intergenic
1106936338 13:34725768-34725790 ACCAAGATAGATCATATGCAGGG + Intergenic
1107371662 13:39757064-39757086 TCCAAGATAGACCATATGTTAGG + Intronic
1107847226 13:44528272-44528294 ACCAAAACAGACCACATTCTGGG + Intronic
1108189256 13:47920378-47920400 TCCAAGATAGACCATATGATAGG + Intergenic
1108632417 13:52299522-52299544 TCCAAGATAGACCATATGTTAGG - Intergenic
1108635257 13:52327682-52327704 TCCAAGATAGACCATATGTTAGG + Intergenic
1108652553 13:52495547-52495569 TCCAAGATAGACCATATGTTAGG - Intergenic
1108654286 13:52513072-52513094 TCCAAGATAGACCATATGTTAGG + Intergenic
1108817310 13:54307600-54307622 TCCAAGATAGACCATATGATAGG + Intergenic
1109196974 13:59389051-59389073 TCCAAGATAGACCATATGATAGG - Intergenic
1109243740 13:59926743-59926765 TCCAGAATAGACCATATGTTAGG - Intronic
1109259490 13:60126625-60126647 ACCAAGATAGACCATGTTCTGGG + Intronic
1109508155 13:63334306-63334328 TCCAAGATAGACCATATGATAGG - Intergenic
1109617995 13:64862384-64862406 TCCAATATAGACCATATGATAGG - Intergenic
1109659383 13:65438107-65438129 TCCAAAATTGACCATATGTTTGG + Intergenic
1109679813 13:65735762-65735784 TTCAGAATAGACCATATGCCAGG + Intergenic
1109822404 13:67675189-67675211 TCCAAGATAGACCATATGATAGG - Intergenic
1109990927 13:70056552-70056574 TCAAAGATAGACCATATGACTGG + Intronic
1110088622 13:71415358-71415380 TCCAAAATAGACCATATTTTAGG - Intergenic
1110088942 13:71420313-71420335 TCCAAAATAAACCATATGCTTGG - Intergenic
1110340707 13:74386660-74386682 TCCAAGATAGACCATATGATAGG - Intergenic
1110360431 13:74618804-74618826 ACCAAAACAGACCAAATACTGGG + Intergenic
1110375789 13:74792512-74792534 TCCAAGATAGACCATATGATAGG - Intergenic
1110825887 13:79971512-79971534 TCTAAAATAGACCATATGCTTGG - Intergenic
1110881777 13:80580393-80580415 TCCAACATAGACCATATGATAGG + Intergenic
1110916179 13:81023797-81023819 TCCAAAATTGACCATATACTTGG + Intergenic
1111036606 13:82682463-82682485 TCCAAGATAGACCATATGATAGG + Intergenic
1111148702 13:84219138-84219160 TCCAAGATAGACCATATGATAGG + Intergenic
1111165533 13:84453252-84453274 TCCAAGATAGACCATATGATAGG - Intergenic
1111363757 13:87212375-87212397 ACCAACATGGACCATATGCTGGG + Intergenic
1111382097 13:87470334-87470356 ACCAAATTAGACCACATTCTGGG + Intergenic
1111545598 13:89730779-89730801 ACCAAGATAAACCATATTTCAGG - Intergenic
1112307713 13:98290202-98290224 ACCTAACTACATCATATGCCAGG + Intronic
1112418276 13:99223896-99223918 ACCAAAATAGACTATATTCTGGG - Intronic
1112425171 13:99291497-99291519 ACCAAAATAGACCATTTTAAGGG + Intronic
1112596908 13:100815873-100815895 AGTAAAATAGGCCAGATGCCAGG - Intergenic
1112772753 13:102809408-102809430 ACCAAGATAGACCATATGTTGGG - Intronic
1113637929 13:111934252-111934274 TCCAAGATAGACCATATGACAGG - Intergenic
1113798335 13:113073232-113073254 ACCAAGAAAGACCATATTCTTGG - Intronic
1113921060 13:113911080-113911102 ACTAAGATAGACCATATCCTGGG - Intergenic
1113980977 13:114275488-114275510 GCCAAAATGGGCCAAATGCCAGG - Intergenic
1114030574 14:18575771-18575793 TCCAAGATAGACCATATGATAGG - Intergenic
1114540684 14:23455633-23455655 ACCAAAAAAAACCCTATACCTGG + Intergenic
1114783478 14:25567283-25567305 TCAAAGATAGACCATATGTCAGG - Intergenic
1115350410 14:32388767-32388789 TCCAATATAGACCATATGATAGG - Intronic
1115371596 14:32621586-32621608 TCCAAGATAGACCATATGATAGG - Intronic
1115394130 14:32888359-32888381 ACCAAAATAGAATATATTCTGGG + Intergenic
1115668769 14:35585214-35585236 ACCAAGACAGACCATATTCTGGG + Intronic
1115684434 14:35780447-35780469 TCCAAAATAGACCATATGTAAGG + Intronic
1115719953 14:36149392-36149414 ACCAAGATAGACCACATTCTGGG - Intergenic
1115821593 14:37218528-37218550 ACCAAAATAGACCCTATTCTGGG - Intronic
1115915456 14:38307820-38307842 ACCAAGATAGTCCATATTCTGGG + Intergenic
1115937896 14:38575608-38575630 TCCAAGATAGACCATATGATAGG - Intergenic
1116038604 14:39658593-39658615 TCCAAAATTGACCACATACCTGG + Intergenic
1116048812 14:39778886-39778908 TCCAAGATAGACCATATGATAGG - Intergenic
1116285532 14:42967452-42967474 AACAAAATTGACCAAATGTCAGG + Intergenic
1116406299 14:44570388-44570410 TCCAAAATAGACCACATGATAGG + Intergenic
1116751132 14:48885801-48885823 ACCAAGATAGACCATGTTCTGGG - Intergenic
1116796243 14:49393624-49393646 TCCAAAATTGACCATATGGTTGG + Intergenic
1116847367 14:49877547-49877569 ACCAAAATAGACCATACCCTGGG - Intergenic
1116900810 14:50361064-50361086 AACAAAACAAAACATATGCCTGG - Intronic
1117121867 14:52576766-52576788 TCAAAAATTGACCATATGCTGGG + Intronic
1117182430 14:53204898-53204920 TCCAAGATAGACCATATGATAGG + Intergenic
1117240945 14:53831926-53831948 TCCAAGATAGACCATATGATAGG + Intergenic
1117509906 14:56440488-56440510 TCCAAGATAGACCATATGATAGG - Intergenic
1117640065 14:57788492-57788514 TCCAAGATAGACCATATGATAGG + Intronic
1117655204 14:57948949-57948971 TCCAAGATAGACCATATGATAGG - Intronic
1117992421 14:61447518-61447540 ACCAACATAGACCACATTCTGGG + Intronic
1118138606 14:63055073-63055095 GCCAGGATAGAGCATATGCCAGG - Intronic
1118497200 14:66319164-66319186 TCCAAGATAGACCATATGTTAGG + Intergenic
1119096943 14:71841662-71841684 ACCATGATAGACCATATTCTAGG - Intergenic
1119098701 14:71858678-71858700 TCCAAGATAGACCATATGATAGG + Intergenic
1119413068 14:74448608-74448630 ACCAAGATAGACCATATTTTGGG + Intergenic
1119606044 14:76018462-76018484 TCCAGAATAGACCATATGTTAGG - Intronic
1119697870 14:76728093-76728115 CTCAAAATAGTCAATATGCCAGG - Intergenic
1119913924 14:78377997-78378019 ACCAAGATAGACCACATCCTGGG + Intronic
1120069932 14:80091240-80091262 TCCAAAATTGACCATATACTTGG + Intergenic
1120326411 14:83034903-83034925 ACCAAAATAGAACATATGCTGGG + Intergenic
1120345029 14:83276981-83277003 TCCAAAATAGAACATATGTTAGG + Intergenic
1120365667 14:83565023-83565045 TCCAGAATAGACCATATGTTAGG - Intergenic
1120489823 14:85163245-85163267 TCCAAGATAGACCATATGATAGG + Intergenic
1120736129 14:88055161-88055183 TCCAAGATAGACCATATGATAGG - Intergenic
1120740520 14:88104414-88104436 TCCAGAATAGACCATATGTTAGG - Intergenic
1120785504 14:88531014-88531036 TCCAAGATAGACCATATGATAGG + Intronic
1120952636 14:90056622-90056644 ACTAAAATAGACCATCTGGTTGG + Intergenic
1121041020 14:90747544-90747566 ACCAAGATTGACCATATACAGGG - Intronic
1121264793 14:92594085-92594107 ACCAAGATAGACCACATCCTGGG + Intronic
1121460096 14:94068588-94068610 TCCAAGATAGACCATATGATAGG + Intronic
1121575662 14:94983910-94983932 TCCAAGATAGACCATATGATAGG + Intergenic
1121601353 14:95206489-95206511 ACCAAAAGAAACCATGTGCTGGG + Intronic
1121621652 14:95353963-95353985 ACCAAAGTAGGCCATATTCTGGG + Intergenic
1121684368 14:95822751-95822773 ACCAAGATAGACCATAGCCTGGG + Intergenic
1121745376 14:96285794-96285816 ACCAAATTAGGCCAGATGTCCGG - Exonic
1121906043 14:97746219-97746241 ACCAAAATAGATCATATACTAGG - Intergenic
1121939031 14:98050598-98050620 ACCAAGATAGACTATATTCTGGG + Intergenic
1121978888 14:98435363-98435385 ACCAAAAAAGATGAAATGCCAGG - Intergenic
1122039695 14:98976367-98976389 ACCAAAATAGAACATATTCTGGG + Intergenic
1122196321 14:100089357-100089379 ACCAAAATAGACCATATGCTGGG + Intronic
1122487700 14:102092459-102092481 AACAAAATAGACCATATTCTGGG - Intronic
1122839555 14:104450425-104450447 ACCAAGATTGACCATATTCTAGG + Intergenic
1123010108 14:105345748-105345770 ACCAAGATAGACCATAGGCTGGG - Intronic
1123697131 15:22886695-22886717 ACCAAGATAGACCATACGCTGGG - Intronic
1124242329 15:28039377-28039399 TCCAGAATAGACCATATGTTAGG + Intronic
1124557363 15:30738705-30738727 TCCAAGATAGACCATATGATAGG + Intronic
1124668029 15:31610532-31610554 TCCAAGATAGACCATATGATAGG + Intronic
1124668450 15:31615669-31615691 ACCAAAATTGATCATATGCTAGG + Intronic
1124714690 15:32049062-32049084 CCCAAAATTGACCACATACCTGG - Intronic
1124864958 15:33480761-33480783 ACCAACATAGACCATATGCTGGG - Intronic
1124936931 15:34181975-34181997 TCAAAAATTTACCATATGCCAGG + Intronic
1125012550 15:34895930-34895952 ACCAAGAGAGATCATATGCTGGG + Intronic
1125135887 15:36342313-36342335 TCCAAGATAGACTATATGCTGGG + Intergenic
1126016258 15:44354216-44354238 ACCAAGATAGACCATAAAACGGG + Intronic
1126445181 15:48735090-48735112 TCCAGGATAGGCCATATGCCAGG + Intronic
1126521272 15:49597198-49597220 TCCAAGATAGACCATGTGACAGG + Intronic
1127007971 15:54592209-54592231 TCCAAGATAGACCATATGATAGG - Intronic
1127014717 15:54671063-54671085 TCCAAGATAGATCATATGACAGG + Intergenic
1127036272 15:54921543-54921565 TCCAAGATAGACCATATTACAGG - Intergenic
1127167791 15:56265752-56265774 ACCAAGATAGACGATATTCTGGG - Intronic
1127326649 15:57902149-57902171 AACAAAATAGACCACTAGCCAGG - Intergenic
1127533493 15:59867682-59867704 AAAAAAATATGCCATATGCCAGG - Intergenic
1127573736 15:60270081-60270103 TCCAAGATAGACCATATGATAGG - Intergenic
1127748361 15:62004937-62004959 TCCAAAATTGACCATATACTTGG - Intronic
1127886692 15:63207718-63207740 ACCAAAAAAGAAAATTTGCCGGG - Intronic
1128211054 15:65902752-65902774 ACCAGATGAGACCAAATGCCAGG - Intronic
1128461496 15:67871430-67871452 ACCAAAGTAGACCACATTCTGGG + Intergenic
1129195575 15:73963993-73964015 AGCAAGATAGACCATATTCTGGG - Intergenic
1129517779 15:76167172-76167194 AACAAAAGAAACCATATGGCTGG + Intronic
1129631927 15:77269714-77269736 TCCAAGACAGACCATATGACAGG + Intronic
1129928851 15:79391485-79391507 TCCAAGATAGACCATATGATAGG - Intronic
1130211112 15:81923186-81923208 TCCAAGATAGACCATATGTTAGG + Intergenic
1130359393 15:83167878-83167900 TCCAAGATAGACCACATGCTTGG + Intronic
1130364053 15:83217628-83217650 ACCAAAATTGTCCATATGCTAGG + Intergenic
1130414355 15:83677186-83677208 ACCAAAACAGACCATATTATTGG - Intronic
1130582024 15:85146282-85146304 ACCAAGACAGACCATATCCTGGG + Intergenic
1130663138 15:85847041-85847063 ACCAAGTTAGACCATATGCTGGG + Intergenic
1130786528 15:87103667-87103689 ACCAAAATAGACCACATTCTTGG + Intergenic
1130933069 15:88445886-88445908 ACCAACATAGTCTATATGCTAGG + Intergenic
1131084244 15:89562545-89562567 ACCAAGATACACCATATCCTGGG + Intergenic
1131101858 15:89697549-89697571 ACCAAGACAAACCATATTCCAGG - Intronic
1131326617 15:91453944-91453966 TCCAAGATAGACCATATGATAGG - Intergenic
1131631706 15:94183933-94183955 ACAAAATTAGACCATATACTGGG + Intergenic
1131790858 15:95963699-95963721 ACCAAGGTAGACCATATGCTAGG + Intergenic
1132253991 15:100358280-100358302 TCCAAGATAGACCATATGATAGG + Intergenic
1132296941 15:100744602-100744624 ACCAAAATGGACCATATTCTGGG - Intergenic
1132304013 15:100795962-100795984 ACCAAGATATACCATATGATAGG + Intergenic
1133282128 16:4672593-4672615 TGCAACAGAGACCATATGCCCGG - Intronic
1133342948 16:5049430-5049452 TCCAAAATAGACCATATGTTAGG + Intronic
1133375270 16:5281339-5281361 TCCAGGATAGACCATATGCTAGG - Intergenic
1134805788 16:17123587-17123609 TCCAAGATAGACCATATGATAGG - Intronic
1134837433 16:17373610-17373632 ACCAACATACAGCATGTGCCAGG + Intronic
1135203076 16:20456377-20456399 TCCAAGATAGACCATATGATAGG + Intronic
1135216023 16:20571484-20571506 TCCAAGATAGACCATATGATAGG - Intronic
1135237674 16:20773771-20773793 TCCAGAATAGACCATATGTTAGG - Intronic
1135333156 16:21578008-21578030 ACCAAGATAGACCATCTTCTGGG + Intergenic
1135520319 16:23171856-23171878 TCCAGGATAGACCATATGACAGG + Intergenic
1135917652 16:26620438-26620460 TCCAAGATAGACCATATGATAGG - Intergenic
1136281609 16:29215476-29215498 ACCAAGATAGACCATATTCCAGG + Intergenic
1136735750 16:32465632-32465654 TCCAAGATAGACCATATGATAGG - Intergenic
1136932306 16:34430239-34430261 TCCAAGATAGACCATATGATAGG - Intergenic
1136972266 16:34981575-34981597 TCCAAGATAGACCATATGATAGG + Intergenic
1137301431 16:47151963-47151985 ACCAAGATAGACCATATTCTGGG - Intergenic
1137337859 16:47568935-47568957 TCCAAGATAGACCATATAACAGG - Intronic
1137473638 16:48786630-48786652 ACCAAAATTGAACATATTCTGGG - Intergenic
1137489764 16:48922509-48922531 ACCAAGATAGACCATATTAAGGG - Intergenic
1137752211 16:50873461-50873483 ACCAAAATAGACTATATATTTGG - Intergenic
1138253021 16:55520588-55520610 ACCGACATAGACCAAATGCTGGG + Intronic
1138481402 16:57305689-57305711 ACCAGAATAGACCAAAGGCCAGG + Intergenic
1138518526 16:57555082-57555104 ACAAAAATAGACCATATTCTGGG - Intronic
1139023224 16:62779215-62779237 TCCAGAATAGATCATATGTCAGG - Intergenic
1139987684 16:70913541-70913563 TCCAAGATAGACCATATGATAGG - Intronic
1140064155 16:71595831-71595853 TCCAAGATAGACCATATGATAGG + Intergenic
1140081491 16:71751743-71751765 ACCAAGAAAGACCATATTCTGGG + Intronic
1140324258 16:73986122-73986144 TCCAAGATAAACCATATGCTAGG + Intergenic
1140531080 16:75666806-75666828 TCCAAGATAGACCATATGATAGG + Intronic
1142085981 16:88181408-88181430 ACCAAGATAGACCATATTCCAGG + Intergenic
1203017325 16_KI270728v1_random:363942-363964 TCCAAGATAGACCATATGATAGG + Intergenic
1203035660 16_KI270728v1_random:637100-637122 TCCAAGATAGACCATATGATAGG + Intergenic
1143969097 17:10780001-10780023 AACAAAATACACCATATGGAAGG - Intergenic
1143991058 17:10962165-10962187 TCCAAGATAGACCATATGATAGG + Intergenic
1144048568 17:11476673-11476695 ACCAAGATAGACCATATTCTGGG - Intronic
1144139436 17:12334255-12334277 TCCAAGATAGACCATATGATAGG - Intergenic
1144278142 17:13696924-13696946 TCCAAGATAGACCATATGATAGG - Intergenic
1144370680 17:14588375-14588397 AGCAAGATAGACCATATACTGGG + Intergenic
1144407945 17:14970971-14970993 TCCAAGATAGACCATATGATAGG + Intergenic
1144616310 17:16777438-16777460 TCCAAAATAGACCATATGATAGG + Intronic
1144743751 17:17599420-17599442 GCCAAAACAGACCCTATGCTGGG + Intergenic
1144746577 17:17619813-17619835 ACCAAGATAGACCACATTCTGGG + Intergenic
1144896394 17:18538221-18538243 TCCAAAATAGACCATATGATAGG - Intergenic
1145135823 17:20405996-20406018 TCCAAAATAGACCATATGATAGG + Intergenic
1145688098 17:26698288-26698310 TCCAAAATTGACCATATACTTGG - Intergenic
1146037939 17:29424084-29424106 ACCAAAATACACCATATACTGGG - Intronic
1146292371 17:31618450-31618472 TCCAAGATAGACCATATGTTGGG - Intergenic
1146410804 17:32582563-32582585 GCCAGAATAGACCATATTCTGGG - Intronic
1146463804 17:33069248-33069270 ACCAAGATAGACCATATTCTGGG - Intronic
1147173803 17:38638488-38638510 AACAAAATTGACCATATGCTGGG + Intergenic
1147503485 17:40989478-40989500 ACCAAAATAGACTATATTCTGGG - Intergenic
1147891375 17:43719757-43719779 AACAAAATAGACCAAATGAGAGG - Intergenic
1148400358 17:47354287-47354309 TCCAAGATAGACCATATGGTAGG - Intronic
1148408018 17:47437175-47437197 TCCAAGATAGACCATATGATAGG - Intronic
1148574193 17:48697251-48697273 TTCAAAATAGACCATATCCTGGG - Intergenic
1148672516 17:49421337-49421359 TCCAGAATAGACCATATGTTAGG - Intronic
1149052524 17:52324164-52324186 TCCAAGATAGACCATATGAGAGG + Intergenic
1149175907 17:53869715-53869737 ACCAAGATAGAACATATCCTGGG - Intergenic
1149673875 17:58441080-58441102 ACCAAGATAGACCATACACTGGG + Intronic
1150089534 17:62310737-62310759 ACCAGGCTAGACCATATGCTAGG - Intergenic
1150111129 17:62500688-62500710 ACCAAAATAGACCATATGCTGGG + Intronic
1150171970 17:63006661-63006683 ACCAAAATGGACCATATGTTAGG - Intergenic
1150512505 17:65771548-65771570 ATCAAGATAGACCATATTCTGGG + Intronic
1150664306 17:67117209-67117231 ACCAAAATAAACCACATTCTGGG + Intronic
1150818109 17:68411540-68411562 TCCAAAATAGACCACATACTTGG - Intronic
1150945252 17:69738920-69738942 TCCAAGATAGACCATATGATAGG - Intergenic
1151110495 17:71670789-71670811 ACCAAGATAAACCATATGATTGG + Intergenic
1152326515 17:79643514-79643536 ACCAAGATAGATCATGTGCTGGG + Intergenic
1152428375 17:80231850-80231872 ACTAAGATAGACCATATTCAGGG - Intronic
1152585023 17:81185216-81185238 ACCAAAATTGTCCAAATGCTGGG + Intergenic
1152872356 17:82762975-82762997 AACAAAACAGACCATACGCTGGG - Intronic
1152902714 17:82953260-82953282 AACAAAATAGACCACTAGCCAGG + Intronic
1152953935 18:19876-19898 TCCAAGATAGACCATATGATAGG + Intergenic
1152981053 18:277166-277188 ACCAAAATAGACCATATGCTTGG + Intergenic
1153065681 18:1042107-1042129 TCCAAGATAGACCATATGATAGG + Intergenic
1153069264 18:1086960-1086982 TCCAAGATAGACCATATGATAGG - Intergenic
1153079324 18:1202630-1202652 ACCAAAATTGCCCATAAGCTGGG - Intergenic
1153148796 18:2066461-2066483 ACAAAAATTTACCAAATGCCAGG + Intergenic
1153164495 18:2246678-2246700 TCCAAGATAGACCATATGATAGG + Intergenic
1153176094 18:2375175-2375197 TCCAAGATAGACCATATGATAGG - Intergenic
1153189765 18:2524698-2524720 ACCAAAATAAACCATATGCTGGG + Intergenic
1153268948 18:3299636-3299658 TCCAAGATAAACCATATGACAGG + Intergenic
1153320304 18:3766551-3766573 ACCAAAATAGTCCATATTTGGGG + Intronic
1153503506 18:5771718-5771740 TGCAAAATAAACCATTTGCCAGG + Intergenic
1153556403 18:6318857-6318879 TCCAAGATAGACCATATAACAGG + Intronic
1154407161 18:14103272-14103294 TCCAGGATAGACCATATGCTAGG + Intronic
1155090805 18:22508398-22508420 TCCAGGATAGACCATATGCTAGG - Intergenic
1155553181 18:26988764-26988786 AACAAAATAGAACATAAGTCTGG + Intronic
1155573605 18:27221585-27221607 TCCAAGATAGACCATATGACAGG - Intergenic
1155842730 18:30666692-30666714 CCCAAAATAGACTATATACTAGG + Intergenic
1156011088 18:32498785-32498807 TCCAAGATAGACCATATGATAGG - Intergenic
1156040647 18:32817187-32817209 ACCAAAATTAAACATATGCTGGG + Intergenic
1156165171 18:34410305-34410327 TCCAAAATAGACTATATGCTGGG - Intergenic
1156256326 18:35400400-35400422 ACCAAAACTGACCATATGCTGGG + Intergenic
1156378749 18:36537917-36537939 ACCAAGATAGACCATATACTGGG + Intronic
1156667711 18:39427994-39428016 TCCAAGATAGACCATATGCTAGG + Intergenic
1156893138 18:42213177-42213199 TCCAAGATAGACCATATGATAGG - Intergenic
1157218819 18:45809447-45809469 TCCAAGATAGACCATATGATAGG + Intergenic
1157667133 18:49497186-49497208 AACAAAATAAACAATAGGCCGGG - Intergenic
1157703015 18:49776649-49776671 TCCAAGATAGACCATATGATAGG - Intergenic
1158002849 18:52638931-52638953 TCCAAGATAGACCATATGACAGG + Intronic
1158176899 18:54667595-54667617 TCCAAAATTGACCACATACCTGG - Intergenic
1158501438 18:58005686-58005708 TGCAAATTATACCATATGCCTGG - Intergenic
1158787769 18:60736937-60736959 ACCAAAATAGACTATACTTCTGG - Intergenic
1158910251 18:62053825-62053847 ACCAAGATAGATCATATTCTGGG + Intronic
1159101054 18:63959550-63959572 ACCAAAAGAGACCACATTCTGGG - Intronic
1159134207 18:64318101-64318123 ACCAAAAGAGACCATATTTTTGG - Intergenic
1159817740 18:73097260-73097282 ACTAAGATAGACCATATCCAGGG - Intergenic
1160059058 18:75513419-75513441 TCCAAGATAGACCATATGATAGG + Intergenic
1161186958 19:2927473-2927495 ACCAAAATAGAAAATAGGGCCGG + Intergenic
1162058320 19:8079062-8079084 ACCAAAAGAGAACATTTGGCTGG - Intronic
1162610952 19:11751954-11751976 AAAAAAATAGACCATATGTTAGG - Intergenic
1162888463 19:13714131-13714153 ATCACAATAGCCCATATGCTGGG + Intergenic
1164267701 19:23635993-23636015 ACCAAGACAGACCATATGACAGG + Intronic
1164422628 19:28109073-28109095 ACCAAGATAGACCATATGACAGG + Intergenic
1164815427 19:31197037-31197059 ACCAAGATAGACCACATTCTGGG + Intergenic
1164894102 19:31854493-31854515 ACCAAAATAGACTACATTCTTGG + Intergenic
1164993414 19:32701076-32701098 ACCAAGATAGAACATATTCATGG - Intronic
1165604104 19:37085347-37085369 ATCAAAATAAACCAGATGCTGGG - Intronic
1165615343 19:37194806-37194828 ACCAAGATAGACCATACCCTAGG + Intronic
1165670132 19:37671094-37671116 TTCAAAATAGACCATATGCTGGG + Intronic
1165983217 19:39744023-39744045 TCCAAGATAGACCATATGATAGG - Intergenic
1166020829 19:40027629-40027651 AACAACATAAACCATAGGCCAGG - Intergenic
1166262965 19:41655134-41655156 TCCAAGATAGACCATATGATAGG + Intronic
1168458137 19:56531214-56531236 TCCAAGATAGACCATATGATAGG - Intergenic
1168571015 19:57469861-57469883 ACCAAGATAGCCCATATTCTGGG + Exonic
924992630 2:326440-326462 TCCAAGATAGACCATATGATAGG - Intergenic
925316277 2:2927631-2927653 ACCAAGATAGACCACATTCTGGG - Intergenic
925598333 2:5581657-5581679 ACCAAAATAGATCATATGTTGGG - Intergenic
925667091 2:6269822-6269844 ACCAAAATGAACCATATTCTGGG + Intergenic
926187462 2:10702373-10702395 TTCAAAATGGACCATAGGCCAGG + Intergenic
926262055 2:11273707-11273729 TCCAAAACAGATCATATGTCAGG + Intronic
926515165 2:13835317-13835339 ACCAAAATTAACTATATGCCAGG + Intergenic
926560411 2:14410752-14410774 CCCAAAATAGACCACATGATAGG + Intergenic
926915770 2:17890841-17890863 TCCAAGATAGACCATATGATGGG - Intronic
926981104 2:18569931-18569953 ATCAAGATAGACCATATTCTTGG + Intronic
927036491 2:19182870-19182892 TCCAAGATAGACCATATGATAGG - Intergenic
927080180 2:19619811-19619833 TCCAAGATAGACCATATGATAGG + Intergenic
927227462 2:20783232-20783254 ACCAAGATAGACTACATTCCGGG - Intronic
927363466 2:22264747-22264769 ACTGAAATAGACCATATTCTAGG - Intergenic
927421401 2:22935630-22935652 ACCAAAATATACTATATTCTGGG + Intergenic
927868002 2:26605003-26605025 ACCAAGATAGACCATATTCAGGG + Intronic
928250942 2:29678798-29678820 TTCAATATAGACCATATGCCAGG - Intronic
928443001 2:31308950-31308972 TCCAAGATAGACCATATGATAGG - Intergenic
928704447 2:33932791-33932813 ACCAAGACAGTCCATATGCTGGG - Intergenic
928733937 2:34263726-34263748 TCCAAGATAGACCATATGATAGG + Intergenic
928798641 2:35058038-35058060 TCCAAGATAGACCATATGATAGG - Intergenic
928856199 2:35805376-35805398 CCCAAGATAGACCATATGATGGG + Intergenic
928861803 2:35867017-35867039 ACCAAAATAGACCATATGTTGGG + Intergenic
929070615 2:38027044-38027066 ACCAAAATAGAACATATTCTGGG - Intronic
929398928 2:41557123-41557145 TCCAAGATAGACCATATGATAGG + Intergenic
929740339 2:44592832-44592854 ACCAAGCTAGACCATATTCTAGG - Intronic
929811957 2:45197100-45197122 ACCAACAAGGACCATATCCCAGG + Intergenic
930469071 2:51790931-51790953 ACCTAGATAGAGCATATGCTAGG + Intergenic
930891775 2:56397995-56398017 ACCAAGATAGACCACATTCTGGG - Intergenic
930906734 2:56577775-56577797 TCCAAGATAGAACATATGCTAGG + Intergenic
930950091 2:57130579-57130601 ACCAAGATGGACCATATTCTGGG - Intergenic
930988387 2:57618459-57618481 TCCAAGATAGACCATATGATAGG + Intergenic
931192289 2:60015770-60015792 ACCAAAATAGACCATATTCTGGG + Intergenic
931275248 2:60738491-60738513 ACCAAAATTGACCATAACCTGGG - Intergenic
931526267 2:63158215-63158237 ACCAAAACAGACCATATCCTGGG - Intronic
931567564 2:63630823-63630845 ACCAAGATAGACCTTATTCTAGG + Intronic
931834861 2:66087998-66088020 TCCAAGATAGACCATATGATAGG + Intergenic
932100326 2:68893682-68893704 TCCAAGATAGACCATATGATAGG - Intergenic
932107992 2:68966030-68966052 ACCGAGATAGACCACATGCTAGG + Intergenic
932361241 2:71108046-71108068 ACCAAGATAGACCATATCTTGGG - Intergenic
932954415 2:76335076-76335098 TCCAGAATAGACCATATGACAGG - Intergenic
933024609 2:77240011-77240033 ATCAAGATAGACCATATTCTGGG + Intronic
933148540 2:78886546-78886568 ACCAACATAGACCACATTCTGGG + Intergenic
933264127 2:80163518-80163540 ACCAAGATATACCATATCCTGGG - Intronic
933625997 2:84599967-84599989 AACAAAATTGACCATATTCTGGG - Intronic
933661422 2:84930431-84930453 ACCAAGATAAACCATATTCAGGG + Intergenic
933936743 2:87211083-87211105 ATCAAGATAGACCATATCCAGGG - Intergenic
934177527 2:89589235-89589257 TCCAAGATAGACCATATGATAGG - Intergenic
934186924 2:89754740-89754762 TCCAAGATAGACCATATGATAGG - Intergenic
934287824 2:91663537-91663559 TCCAAGATAGACCATATGATAGG - Intergenic
934310067 2:91854375-91854397 TCCAAGATAGACCATATGATAGG + Intergenic
934626576 2:95862253-95862275 ACCAAAATAGACCATATTTTAGG + Intronic
934806982 2:97239041-97239063 ACCAAAATAGACCATATTTTAGG - Intronic
934830524 2:97518134-97518156 ACCAAAATAGACCATATTTTAGG + Intronic
935002915 2:99038865-99038887 TCCAAAACAGACCATATGATAGG + Intronic
935119317 2:100167997-100168019 ACCAAAACAGACCATATTTTGGG + Intergenic
935323850 2:101916474-101916496 ACCAAGATAGATCATATCCCGGG + Intergenic
935475732 2:103520254-103520276 ACCAAGATAGACCATATTCTGGG - Intergenic
935505828 2:103901325-103901347 GCCAAAATTGACCATATGAGGGG - Intergenic
935512198 2:103990014-103990036 ACCAAGATAGACCATATCCCGGG - Intergenic
935610222 2:105015210-105015232 TCCAAGATAGACCATATGATAGG - Intergenic
935662599 2:105481146-105481168 ATCAACATAGACCATATTCTGGG + Intergenic
935988746 2:108699957-108699979 ACCAAGATAGACTATATCCTGGG + Intergenic
936141107 2:109941469-109941491 TCCAAAATAGACCATATGATAGG + Intergenic
936177795 2:110239414-110239436 TCCAAAATAGACCATATGATAGG + Intergenic
936203586 2:110430017-110430039 TCCAAAATAGACCATATGATAGG - Intronic
936225562 2:110646543-110646565 ACCAAAATAGACAACATTCTGGG + Intronic
936273964 2:111075987-111076009 ACCAAGATAGACCATATCCTGGG - Intronic
936356402 2:111754742-111754764 ATCAAGATAGACCATATCCAGGG + Intergenic
936899087 2:117463862-117463884 TCCAAGATAGACCATATGATAGG - Intergenic
936910926 2:117592751-117592773 TCCAAGATAGACCATATGATAGG - Intergenic
937058607 2:118963503-118963525 ACCAAAATAGATGATATCCTAGG - Intronic
937146640 2:119651664-119651686 ACCAAAATTGACCATATCTTGGG - Intronic
937480535 2:122253883-122253905 TCCAAGATAGACCATATGATAGG + Intergenic
937649707 2:124306473-124306495 ACCAACATAGGTCATATTCCTGG - Intronic
937897439 2:126988998-126989020 ACCAATGTAGACCATATCCTAGG - Intergenic
938059994 2:128246114-128246136 ACCAAGATAGACCACATTTCAGG + Intronic
938202911 2:129391081-129391103 ATCAAGATAGACCATATTCTAGG + Intergenic
938598023 2:132809182-132809204 TCCAAGATAGACCATATGATAGG - Intronic
939232868 2:139453511-139453533 TCCAAAATAGACCATATATTAGG - Intergenic
939245545 2:139618962-139618984 TCCAAGATAGACCATATGACAGG - Intergenic
939824050 2:146993209-146993231 TCCAATATAAACCATATGCCAGG + Intergenic
940471124 2:154102057-154102079 TTCAAAATTGACCATATACCTGG - Intronic
940567194 2:155381403-155381425 ACTAAAATAGAGCTTGTGCCTGG - Intergenic
940606835 2:155935377-155935399 ACCAAAATAGGCCACATGCTAGG - Intergenic
940705155 2:157095906-157095928 ACCAAGATAGGCCATATTCTGGG - Intergenic
940762628 2:157753835-157753857 TCCAAGATAGACCATATGATAGG + Intronic
941040557 2:160617502-160617524 GCCAAAATTGTCCATATGCTAGG + Intergenic
941259309 2:163276318-163276340 AACATAATGGACAATATGCCAGG - Intergenic
941279139 2:163528344-163528366 ACCACAATAGACCACATGCTGGG + Intergenic
941566597 2:167116048-167116070 ACCAAGATAGACCATATTCTAGG - Intronic
941679853 2:168385817-168385839 TCCAAGATAGACCATATGATAGG + Intergenic
941975132 2:171395930-171395952 ACCAAGGTAGACCATACGCTGGG + Intronic
942154496 2:173113802-173113824 TCCAAGATAGACCATATGATAGG - Intronic
942626564 2:177907259-177907281 ACTAAAAAAGACCATAAACCTGG - Intronic
942726312 2:179011700-179011722 TCCAAGATAGACCATATGATAGG + Intronic
943194950 2:184734581-184734603 ACCAAGATAGACCACATTCTGGG - Intronic
943198629 2:184790258-184790280 TCCAAAATCGACCATATGATTGG - Intronic
943269304 2:185777053-185777075 TGCAACAGAGACCATATGCCTGG - Intronic
943276907 2:185879026-185879048 TCCAAAATAGATCACATGCTTGG + Intergenic
943301160 2:186202557-186202579 ACCAAAAAAGACCATACGCTGGG + Intergenic
943423779 2:187703216-187703238 TCCAAGATAGACCATATGAAAGG + Intergenic
943621144 2:190149731-190149753 TCCAAGATAGACCATATGATAGG - Intronic
943745505 2:191457712-191457734 ACCAAGAGAGACCTTATGCTGGG - Intergenic
943938386 2:193956938-193956960 ACCAAAATGGACTATATCCTGGG - Intergenic
944027564 2:195189965-195189987 TCCAAAATAGACCATATCCTTGG + Intergenic
944190606 2:196999415-196999437 ACCAAAATAGATGATGTGACGGG - Intronic
944291464 2:198011525-198011547 CCCAAAATAGACCACATGTTAGG - Intronic
944303565 2:198153723-198153745 ACCAATATAGACCATTTTCTGGG + Intronic
944380608 2:199105246-199105268 ACCAAGGTAGACCATATCCTGGG - Intergenic
944392846 2:199236592-199236614 CCCAAAATAGACCACATTCTGGG - Intergenic
944737674 2:202582592-202582614 CCCAAAATAGACCATATCCTTGG - Intergenic
944765681 2:202862059-202862081 ACCGAAACAGACCATATGCTAGG + Intronic
944804106 2:203263823-203263845 ACCAAAAACAACCATATGCAGGG - Intronic
945131784 2:206581635-206581657 TCCAAGATAGACCATATGATAGG - Intronic
945174301 2:207026355-207026377 ACTAAGATAGACCATATGTTAGG + Intergenic
945262486 2:207856960-207856982 ACCAAAAGAGACCACATTCTGGG - Intronic
945397301 2:209335117-209335139 AGCAAAACAGACCAAATGCATGG + Intergenic
945404329 2:209425896-209425918 ACCAAAATACACCTATTGCCCGG - Intronic
945482313 2:210358248-210358270 TCCAAGATAGACCATATGCTAGG - Intergenic
945722219 2:213431826-213431848 TCCAAGATAGACCATATGTTAGG + Intronic
945825980 2:214720335-214720357 TCCAAGATAGACCATATGACAGG + Intergenic
946435835 2:219652579-219652601 ACCAAGATAGACCCTATTCTGGG + Intergenic
946661779 2:222008587-222008609 AGTAAAATAAACCATATCCCAGG + Intergenic
947090487 2:226505232-226505254 ACCAAAATTGACCATATGCTAGG + Intergenic
947146537 2:227071624-227071646 TCCAAGATAGACCATATGACAGG + Intronic
947366249 2:229397605-229397627 ACCAATATAAACCATATTCTGGG + Intronic
947456832 2:230262872-230262894 TCCAAGATAGACCATATGATAGG - Intronic
947547745 2:231023010-231023032 ACCAAGATAGACCATATGCGGGG - Intronic
948019850 2:234722359-234722381 GTCAAAATTGGCCATATGCCAGG + Intergenic
948325160 2:237112236-237112258 ACAAAGATAAACCATATGCTGGG + Intergenic
948533268 2:238627326-238627348 ACAAAAATAGGCCATTGGCCAGG - Intergenic
948767871 2:240232918-240232940 ACCCAAATAGACCTTGTTCCAGG + Intergenic
948833109 2:240609628-240609650 TCCAAAATAGTCCATCTGCTAGG - Intronic
1168900096 20:1356173-1356195 ACCAAGATAGACCATATCCTGGG - Intronic
1168941468 20:1715377-1715399 CACAAAATAGACCATATGCTAGG + Intergenic
1169290491 20:4346458-4346480 ACCAAGATAGACCACATTCTGGG - Intergenic
1169335911 20:4756901-4756923 TCCAAGATAGACCATATGATAGG - Intergenic
1169412675 20:5385637-5385659 TCCAGAATAGACCATATGCTAGG + Intergenic
1169835873 20:9878206-9878228 TCCAAAATAGACTTTATGCTGGG + Intergenic
1170086461 20:12537945-12537967 TCCAAGATAGACCATATGATAGG + Intergenic
1170133766 20:13051664-13051686 TCCAAGATAGACCATATGACAGG + Intronic
1170167080 20:13371564-13371586 ACCAGAATAGACTGTATGTCAGG - Intergenic
1170245519 20:14217929-14217951 TCCAAGATAGACCATATGATAGG - Intronic
1170449618 20:16468919-16468941 ACCAAGACAGACCATATTCTGGG + Intronic
1170489244 20:16855154-16855176 TCCAAGATAGACCATATGATAGG - Intergenic
1170865172 20:20149162-20149184 ACCAAGATAGACCATATTATGGG + Intronic
1171038467 20:21737337-21737359 TCCAAGATAGACCATATGATAGG - Intergenic
1171056701 20:21914272-21914294 TCCAAAATTGACCACATGCTGGG - Intergenic
1171066730 20:22024393-22024415 TCCAAGATAGACCATATGATAGG - Intergenic
1171080344 20:22175803-22175825 TCCAAGGTAGACCATATGGCAGG - Intergenic
1171080564 20:22178616-22178638 ATCATAATAGACCATATGTTAGG + Intergenic
1171165831 20:22969790-22969812 TCCAAGATAGACCATATGATAGG + Intergenic
1171375355 20:24690307-24690329 TCCAAGATAGACCATATGATAGG - Intergenic
1171384390 20:24759120-24759142 ACCAAAAGAGACCATATTCTGGG + Intergenic
1171980672 20:31626296-31626318 ACCAAGATAGACCATATTCTGGG - Intergenic
1172398135 20:34624493-34624515 ACCAAAAAAGGCCATGTGACAGG - Intronic
1172406098 20:34690556-34690578 ACCAAAAAAAAACATAGGCCAGG - Intergenic
1173017674 20:39240454-39240476 ACCAAGATAGGCCATATTCTGGG + Intergenic
1173099978 20:40077295-40077317 ACCAAAATGGACCAGCTGCTGGG + Intergenic
1173745844 20:45436511-45436533 AACAAAATGTACCATATGTCTGG - Intergenic
1175255013 20:57637658-57637680 ACCAAAATGGACCAAATTCTGGG + Intergenic
1175405863 20:58727185-58727207 ACCAAAATAGATCATATTCTGGG + Intergenic
1175463188 20:59170546-59170568 ATCAAGATAGACCACATTCCAGG - Intergenic
1176871783 21:14088951-14088973 TCCAGAATAGACCATATGTTAGG - Intergenic
1177089792 21:16753581-16753603 TCCAAACAAGCCCATATGCCAGG - Intergenic
1177108269 21:16988991-16989013 TCCAGAATAGACCATATGTTAGG - Intergenic
1177224916 21:18242054-18242076 ACCAAACAAGACCATATGACTGG - Intronic
1177661407 21:24088171-24088193 TCCAATATAGACCATATGATAGG + Intergenic
1177749888 21:25267791-25267813 TCCAAGATAGAACATATGCTAGG + Intergenic
1177962594 21:27686459-27686481 ACCAAGATAGACAATATGTAGGG - Intergenic
1178038418 21:28611126-28611148 CCCAAGATAGACCATATGATAGG + Intergenic
1178620979 21:34175218-34175240 ACCAAGATAGACCATATCTGGGG + Intergenic
1178659725 21:34496574-34496596 TCCAAGATAGACCATATGATAGG - Intergenic
1178733093 21:35123033-35123055 CCCAAGATAGACCATATGATAGG + Intronic
1178801908 21:35803645-35803667 TCCAAAATAGACCATATGATAGG + Intronic
1178959283 21:37049611-37049633 TCCAAGATAGACCATATGATAGG + Intergenic
1179148700 21:38792323-38792345 ACCAAGATAGGCCAAAAGCCAGG - Intergenic
1179390746 21:40988732-40988754 GCCAAAATAGACAATATGGTGGG + Intergenic
1179555177 21:42169844-42169866 ACCAAGATAGACCATATCCCAGG - Intergenic
1179559617 21:42206455-42206477 ACCAAGTTAGACCATATTCTGGG - Intronic
1179638364 21:42729915-42729937 ACCAAGATTGACCATATCCTGGG - Intronic
1180063366 21:45399295-45399317 ACCAAGATAGACCATATCCTGGG - Intergenic
1180097608 21:45565856-45565878 ACCAAAATAGGCCGTATTCTGGG + Intergenic
1180250977 21:46588032-46588054 TCCAAGATAGACCATATGACAGG + Intergenic
1180454688 22:15502827-15502849 TCCAAGATAGACCATATGATAGG - Intergenic
1180536806 22:16400312-16400334 TCCAAGATAGACCATATGATAGG + Intergenic
1180654269 22:17406182-17406204 ACCAAAAGACACCATATTCTGGG - Intronic
1180944544 22:19684058-19684080 ACCAATATAGACCATATTCTGGG + Intergenic
1181445198 22:22966660-22966682 ATCAAAATAGACCATATGTTAGG - Intergenic
1182400172 22:30069594-30069616 CCCAGAATAGACCATATGTCAGG + Intergenic
1182970862 22:34575325-34575347 ACCAAGATAGACCACATTCTAGG - Intergenic
1184307981 22:43620952-43620974 ACCAAGACAGACCATATCCAGGG + Intronic
1184613801 22:45624137-45624159 ACCAAAATAGACCATATGCTGGG - Intergenic
1184632778 22:45797293-45797315 ACCAAGACAGACCATATGCTGGG + Intronic
1184823045 22:46925893-46925915 TCTACAATAGACCATATGCTAGG + Intronic
1184836456 22:47025321-47025343 ACCAAGATAGACCATATTTTGGG + Intronic
1184972343 22:48034283-48034305 GCCAAGATAAATCATATGCCGGG - Intergenic
1185007896 22:48295208-48295230 ACCAAGATAGACCACATTCTGGG + Intergenic
1185183145 22:49374976-49374998 ATGAAAATAGACCATATGCTAGG - Intergenic
949330203 3:2913884-2913906 TCCAAAAGAGACCATATGTTAGG + Intronic
950625129 3:14240504-14240526 ATCAAGATAGACCATATCCTAGG - Intergenic
950699831 3:14734602-14734624 ACCAAAATTGACTATGTGCTGGG - Intronic
950820071 3:15747608-15747630 TCCAAAATAGACCATATGATAGG - Intronic
950893594 3:16427584-16427606 TCCCAAATTGACCATATGCTTGG - Intronic
950914124 3:16626408-16626430 ACCAATATAGCCCATATGAAGGG - Intronic
951153511 3:19321593-19321615 TCCAAGATAGACCATATGATAGG - Intronic
951184023 3:19691075-19691097 TCCAAGATAGACCATATGATAGG + Intergenic
951262016 3:20521362-20521384 TCCAAGATAGACCATATGATGGG - Intergenic
951268242 3:20595353-20595375 TCCAAGACAGACCATATGACAGG - Intergenic
951852182 3:27153532-27153554 TCCAAGATAGACCATATGATAGG + Intronic
952643060 3:35621411-35621433 ACCAAGGCAGACCATATTCCAGG + Intergenic
952775905 3:37046347-37046369 ACCAACACAGACCATATTCTGGG - Intronic
952975515 3:38691827-38691849 ACAAAAATAGTCCGTATGCCTGG - Intergenic
953185502 3:40634055-40634077 TCCAAGATAGACCATATAACAGG + Intergenic
953219573 3:40957286-40957308 TCCAAAATTGACCACATACCTGG - Intergenic
953252225 3:41255942-41255964 TCCAAAATATACCATCTGCTGGG + Intronic
953310048 3:41868030-41868052 ACTAAAACAGACCATATTCTTGG - Intronic
953380559 3:42468680-42468702 ACCAAGACAGACCATATCCAGGG + Intergenic
953382417 3:42482670-42482692 TCCAAGATAGACCATATGTTAGG + Intergenic
953539688 3:43806052-43806074 TCCAAGATAGACCATATGATAGG + Intergenic
953818118 3:46179248-46179270 ACCAAAATTGACAATATCCTGGG - Intronic
953823243 3:46227914-46227936 ACCGAGATAAACCATATGCAGGG - Intronic
953852366 3:46474678-46474700 ACCAAGATAGACCATTTCCTGGG + Intronic
954099861 3:48362647-48362669 ACCAAGATGGACCATATCCTGGG + Intergenic
954852009 3:53610147-53610169 ACCAAGATAGACAATATGCTGGG - Intronic
955175408 3:56609020-56609042 TCCAAAATAGACTATATGACAGG - Intronic
955477310 3:59351203-59351225 TCCAAGATAGACCATATGACAGG - Intergenic
955528417 3:59845689-59845711 TCCAGGATAGACCATATGCAAGG - Intronic
955602748 3:60665188-60665210 ACCAAAATAGATCATATCATAGG - Intronic
955681901 3:61510635-61510657 ATAAAAATAGACCATAAGCTAGG - Intergenic
956303718 3:67801475-67801497 TCCAAGATAGACCATATGTTAGG - Intergenic
956676800 3:71741746-71741768 ACCAAGATAGACCATATTCTGGG + Intronic
957283978 3:78191976-78191998 ACCAAAATTGACCATATGTGGGG + Intergenic
957437073 3:80191927-80191949 ACCAAAAGAGACTACATGCTAGG + Intergenic
958002620 3:87770638-87770660 TCCAAGATAGACCATATGTTAGG - Intergenic
958070335 3:88602532-88602554 CCCAAGATAGACCATATGATAGG + Intergenic
958149591 3:89672475-89672497 TCCAAGATAGACCATATGACAGG + Intergenic
958168088 3:89903058-89903080 ACCAAGAGAGACCATATTCTAGG - Intergenic
958530660 3:95326417-95326439 TCCAAAAGAGACCATATGATAGG - Intergenic
958544568 3:95527212-95527234 ACCAAGATAGACCATATTCTGGG - Intergenic
958775406 3:98477129-98477151 TCCAAGATAGACCATATGATAGG - Intergenic
958977029 3:100679908-100679930 ACCAAAATAGACCAAATGTTGGG - Intronic
959125688 3:102288088-102288110 TCCAAGATAGACCATATGATAGG - Intronic
959168886 3:102819909-102819931 ACCAAAATAGATTATATTCAAGG - Intergenic
959325487 3:104931517-104931539 TCCAAGATAGACCATATGATAGG - Intergenic
959436402 3:106319914-106319936 TCCAAGATAGACCATATGATAGG + Intergenic
959492598 3:107008454-107008476 TCCAAGATAGACCATATGTTAGG + Intergenic
959639262 3:108613716-108613738 ACAAAAATTGGCCATATGCTAGG + Intronic
959715509 3:109428882-109428904 TCCAAGATAGACCATATGATAGG - Intergenic
959722074 3:109503260-109503282 TCCAAGATAGACCATATGATAGG - Intergenic
959899292 3:111641724-111641746 TCCAAGATAGACCATATGATAGG + Intronic
960098560 3:113713305-113713327 ACCAAAATAGACCATATCTTGGG - Intergenic
960113218 3:113865995-113866017 TCCAGAACAGACCATATGCTAGG - Intronic
960114864 3:113884185-113884207 TCCAGAATAGACGATATGCTAGG + Intronic
960152849 3:114268529-114268551 TCCAAAATAGACCATATGATAGG - Intergenic
960243956 3:115379175-115379197 ATAAAAAAAGACCAAATGCCTGG + Intergenic
960296259 3:115948356-115948378 TCCAAAATAGACCATATGATAGG + Intronic
960342661 3:116493733-116493755 ACCATAATAGACTACATACCAGG + Intronic
960437177 3:117641763-117641785 ATCAAGATAGACCATATCCTAGG - Intergenic
960558105 3:119051704-119051726 TCCAAGATAGACCATATGATAGG + Intronic
960748877 3:120923750-120923772 TCCAGAATAGACCATATCTCAGG - Intronic
960753271 3:120980132-120980154 CCCAAAATATACCATATGTCAGG - Intronic
960769924 3:121182247-121182269 TCCAAGATAGACCATATGATAGG + Intronic
960778456 3:121289628-121289650 ACCAGGATAGACCATATGATAGG + Intronic
960832895 3:121868946-121868968 ACTAAGATAGACCATATCCTGGG + Intronic
961062254 3:123839774-123839796 ATCAAGATAGACCATATTCTGGG + Intronic
961113616 3:124308396-124308418 TCCATAATAGACCATATCCTAGG + Intronic
961407401 3:126690970-126690992 TCCAAGATAGACCATATGATAGG + Intergenic
961759578 3:129156057-129156079 ACCAAAATAAAACATATTCTGGG - Intronic
961987284 3:131150237-131150259 ACCAAAATTGACAATATACAGGG - Intronic
962034666 3:131638746-131638768 TCCAAGATAGACCATATGATAGG + Intronic
962334777 3:134517548-134517570 ACCAAAATTGACCATATGCTGGG + Intronic
962401624 3:135065116-135065138 TCCAAGATAGACCATATGACAGG - Intronic
962442265 3:135432000-135432022 TCCAATATAGACCATATGTTAGG + Intergenic
962764865 3:138552401-138552423 TCCAAGATAGACCATATGATAGG + Intronic
962815837 3:138998520-138998542 ACGAAGATAGACCATATTCCAGG - Intergenic
962923353 3:139970563-139970585 ACCGAAATGGTCCAGATGCCTGG - Intronic
962951522 3:140224019-140224041 ACCAAAATATCCCATTTCCCAGG - Intronic
962983794 3:140515778-140515800 TCCAAGATAGACCATATGATAGG - Intronic
963033045 3:140998092-140998114 ACCAACATAGACTATATACTGGG + Intergenic
963171291 3:142253617-142253639 TCCAAGATAGACCATATGATAGG + Intergenic
963176317 3:142301268-142301290 TCCAAGATAGACCATATGATAGG + Intergenic
963330801 3:143913073-143913095 TCAAAAATAGACCATATGTTAGG + Intergenic
963439451 3:145319136-145319158 CCCAAAATAAACCATATGTAAGG - Intergenic
963623187 3:147637599-147637621 TCCAAGATAGACCATATGATAGG + Intergenic
963985110 3:151583878-151583900 ACAAAAATAGTCCATATGTTGGG - Intergenic
964093575 3:152904670-152904692 ATCAACATAGACCATATTCTGGG + Intergenic
964189233 3:153982641-153982663 TCCAAGATAGACCATATGATAGG + Intergenic
964226675 3:154410918-154410940 TCCAAAATAGACCATATGATAGG + Intronic
964268149 3:154923571-154923593 ACCAAGATAGACCACATTCAGGG + Intergenic
964325199 3:155537974-155537996 TCCAAGACAGACCATATGACAGG + Intronic
964397645 3:156263536-156263558 TCCAAGATGGACCATATGCTAGG - Intronic
964867702 3:161279330-161279352 TCCAAGATAGACCATATGATAGG + Intergenic
964916109 3:161844144-161844166 TCCAAGATAGACCATATGATAGG - Intergenic
964997015 3:162894084-162894106 TGCAAAATAGACCATATGTTAGG + Intergenic
965015541 3:163152708-163152730 CCCAAAATAGAGCATATGATAGG - Intergenic
965052500 3:163669059-163669081 TCCAAGATAGACCATATGATAGG - Intergenic
965184785 3:165448859-165448881 TCCAAGATAGACCATATGATAGG + Intergenic
965216640 3:165872594-165872616 TCCAAGATAGTCCATATGACAGG - Intergenic
965525507 3:169712884-169712906 ACCAAGATAGACTATATTCTGGG - Intergenic
965655558 3:170979973-170979995 ACCAAAGTAGATCATATTCTGGG - Intergenic
965717120 3:171617082-171617104 ACCAAAAAAACCCAAATGCCTGG + Intronic
965853124 3:173054844-173054866 ACCAATATAGACCATATCCTGGG + Intronic
965885519 3:173441364-173441386 ACCAAAATAGGCCAAAAGCTAGG - Intronic
966153262 3:176889156-176889178 TCCAAGATAGACCATATGATAGG + Intergenic
966545696 3:181144785-181144807 ACCAAGATAGACCACATCCTAGG + Intergenic
966992178 3:185243747-185243769 TCCAAAATAAATCATATGCTTGG - Intronic
967252632 3:187557793-187557815 ACCAAGATAAACCATATTCTAGG + Intergenic
967601973 3:191400969-191400991 ACTAAAATAGGCAATATCCCAGG - Intergenic
967741937 3:193012903-193012925 ACCAAAACAGACCATAGTCTTGG - Intergenic
967958473 3:194898615-194898637 TCCAAGATAGACCATATGATAGG - Intergenic
968110908 3:196045693-196045715 AGCAAGATAGACCATATACTGGG - Intronic
968250689 3:197209597-197209619 GCCAATACAGACCATATGCTAGG + Intronic
968720861 4:2203075-2203097 TCCAAGATAGACCATATGATAGG + Intronic
969127328 4:4960822-4960844 ACCAAAGTAGTCCATATTCTTGG - Intergenic
969283383 4:6186587-6186609 TCCAGGATAGACCATATGCTAGG - Intronic
969404440 4:6980130-6980152 ACCAAGACAGACCATATTCTGGG + Intronic
970174021 4:13319746-13319768 TCCAGAATAGACCATAAGTCAGG - Intergenic
970217240 4:13772619-13772641 TCCAAGATAGACCATATGGTAGG - Intergenic
970312291 4:14795390-14795412 TCCAAGATAGACCATATGATAGG + Intergenic
970534596 4:17017503-17017525 ACCAAAATAGACTATACTCTGGG - Intergenic
970544928 4:17118186-17118208 ACCAAAATAGACCACATTCTGGG + Intergenic
971576654 4:28283182-28283204 TCCAAAATACACCATATGATAGG + Intergenic
971797493 4:31246981-31247003 TCCAGAATAGACCATATCCTAGG + Intergenic
971859263 4:32083748-32083770 TCCAACATAGACCATATGATAGG - Intergenic
972097124 4:35362154-35362176 TCCAAAATAGACCATATAATAGG - Intergenic
972119247 4:35680258-35680280 TCCAAAATTGACCACATGCTTGG - Intergenic
972122088 4:35716003-35716025 TCCAAAATAGACCACATGTTAGG + Intergenic
972514071 4:39796202-39796224 AAAAAAAAAGACCATATTCCAGG - Intergenic
972827010 4:42770338-42770360 TCCAAGATAGACCATATGGTAGG + Intergenic
973037300 4:45421857-45421879 TCCAAGATAGACCATATGATAGG - Intergenic
973244972 4:48001763-48001785 ACCAAGACAGATCATATGCTGGG + Intronic
973332205 4:48921276-48921298 TCCAAAATAGACCACATACTTGG - Intergenic
973342838 4:49023763-49023785 TCCAAGATAGACCATATGATAGG - Intronic
973346823 4:49065179-49065201 ACCAAAACAGACCATATGCTAGG + Intergenic
973782675 4:54303390-54303412 TCCAAGATAGACCATATGATAGG + Intergenic
973787289 4:54344182-54344204 TCCAAGATAGACCATATGATAGG + Intergenic
973841684 4:54867879-54867901 ACTAAGATAGACCATATGCAGGG - Intergenic
973920365 4:55678165-55678187 TCCAAGACAGACCATATGACAGG + Intergenic
974127342 4:57712464-57712486 TCCAAGATAGACCATATGATAGG + Intergenic
974196503 4:58582509-58582531 AACAAAATAGACCACTAGCCAGG - Intergenic
975276098 4:72503518-72503540 TCCAAGATAGACCACATGCTTGG - Intronic
975338423 4:73208308-73208330 AACAAAATAAACCATATTCTGGG + Intronic
975517525 4:75262901-75262923 TCCAAGATAGACCATATGATGGG + Intergenic
975613885 4:76227453-76227475 TCCAAGATAGACCATATGATAGG - Intronic
975711562 4:77165253-77165275 ATCTAAATAGACCATATGCTAGG + Intronic
975976911 4:80109035-80109057 ACAAAAAAGGACCATATGCTGGG + Intronic
976001541 4:80379811-80379833 ACTAAGATAGACCATATACTGGG - Intronic
976157251 4:82159748-82159770 TCCAAGATAGACCATATGATAGG + Intergenic
976448442 4:85159663-85159685 ACCAATATAGGCCATATGTTGGG + Intergenic
976449616 4:85173143-85173165 ACCAAGATAGACCATATCCCGGG + Intergenic
976529691 4:86137259-86137281 TCCAAAATTGACCATATACTTGG + Intronic
976686101 4:87817143-87817165 TCCAAGATAGACCATATGATAGG - Intergenic
976888083 4:90010106-90010128 TCCAAGATAGACCATATGATAGG + Intergenic
976963517 4:91008142-91008164 TCCAGAATAGACCATACGACAGG - Intronic
977165965 4:93697462-93697484 AACTAAATAGACCAAATTCCTGG - Intronic
977510727 4:97958949-97958971 TCCAAGATAGACCATATGATAGG + Intronic
977552254 4:98454523-98454545 TCTAAGATAGACCATATGACAGG - Intergenic
977589560 4:98811606-98811628 ACCAAGATAGACCACATTCTAGG - Intergenic
977677971 4:99768857-99768879 ACCAAAATTGACCACATACTTGG - Intergenic
977826284 4:101535725-101535747 TCCAAGATAGACCATATGATAGG + Intronic
977855002 4:101878680-101878702 TCAAAAATAGACCATATGTTAGG + Intronic
977975862 4:103266235-103266257 TCCAAGATAGACCATATGATAGG - Intergenic
978095954 4:104778226-104778248 ACAAGGATAGACCATATGCTGGG - Intergenic
978316718 4:107446057-107446079 TCCAAGATAGACCATATGATAGG - Intergenic
978415331 4:108468990-108469012 ACCAAAATAGATCACATTCTGGG + Intergenic
978925888 4:114243516-114243538 TTCAAAGTAGACCATATGCTTGG - Intergenic
978926745 4:114254834-114254856 TCCAAAATAGATCATATTCTTGG + Intergenic
978999209 4:115197149-115197171 TCCAAGATAGACCATATGATAGG - Intergenic
979178487 4:117694859-117694881 TCCAAAATAGATTATATGACAGG + Intergenic
979195168 4:117912745-117912767 TCCGAGATAGACCATATGACAGG - Intergenic
979243548 4:118471907-118471929 ACCAAGATAGAACATATTCTGGG - Intergenic
979306172 4:119146637-119146659 ATCAAGATAGACCATATCCTGGG - Intronic
979355819 4:119703831-119703853 AGCAAGATAGACCAAATGCTAGG + Intergenic
979357214 4:119718438-119718460 TCCAAGATAGACCATATGATAGG + Intergenic
979461052 4:120984576-120984598 TCCAAGATAGACCATATGATAGG - Intergenic
979498218 4:121409079-121409101 TCCAAGATAGACCATATGATAGG - Intergenic
979637368 4:122972832-122972854 ACCAAAACTGACCCTATGCTAGG - Intronic
979927534 4:126586117-126586139 TCCAAAATTGACCATATGCGTGG + Intergenic
980086982 4:128401535-128401557 TCCAAGATAGACCATATGGTAGG - Intergenic
980287759 4:130803127-130803149 TCCAAAATAGACCATATATTTGG - Intergenic
980595144 4:134945150-134945172 ACCAAAATAGACCACATTTTTGG + Intergenic
980701112 4:136432111-136432133 ACCAACATAGACCACATTCTGGG + Intergenic
980761187 4:137236455-137236477 TCCAAGATAGACCATATGATAGG - Intergenic
980878036 4:138681817-138681839 AGAAAACTAGATCATATGCCTGG - Intergenic
981242004 4:142489271-142489293 ACCAAAATAGAGCACATGCTGGG - Intronic
981400761 4:144311390-144311412 TCCAAGATAGACCATATGATAGG - Intergenic
981664679 4:147210059-147210081 ATCAAAGTAGACCATATTCTGGG - Intergenic
981900917 4:149861707-149861729 TCCAGAATAGACCATATGCTAGG + Intergenic
981923571 4:150114158-150114180 TCCAAGATAGACCATATGATAGG - Intronic
982299306 4:153862826-153862848 TCCAAGATAGACCATATGATAGG - Intergenic
982451286 4:155555023-155555045 TCCAAGATAGACCATATGATAGG + Intergenic
982487127 4:155979314-155979336 TCCAAGATAGACCATATGATAGG - Intergenic
982830985 4:160059931-160059953 ACCAATATAGACCATATTCTGGG - Intergenic
982845219 4:160244377-160244399 TCCAAGATAGACCATATGATAGG - Intergenic
982870811 4:160576618-160576640 TCCAAAATTGACCATATACTTGG + Intergenic
982993766 4:162315268-162315290 TCAAAAATTGACCATATGCTTGG - Intergenic
983148273 4:164244182-164244204 TCCAAAATTGACCATATACTGGG + Intronic
983164217 4:164454729-164454751 TCCAAGATAGACCATATGTTGGG + Intergenic
983172987 4:164556912-164556934 TCCAAAATTGACCATATACTGGG - Intergenic
983175474 4:164583377-164583399 TCCAAGATAGACCATATGATAGG - Intergenic
983543593 4:168938545-168938567 AACAAAATAGACCACTAGCCAGG + Intronic
983544645 4:168950508-168950530 TCCAAGATAGACCATATGATAGG - Intronic
983949690 4:173625070-173625092 TCCAGAACAGACCATATGCTAGG - Intergenic
984020404 4:174478287-174478309 TCCAAGATAGACCATATGATAGG + Intergenic
984127040 4:175824149-175824171 ATCCAAAGAGACCATATGTCAGG - Intronic
984283967 4:177706272-177706294 ACAAAAATAGACCCGAGGCCAGG + Intergenic
984513260 4:180705522-180705544 ACAAAAATTGACCAGATGCTTGG - Intergenic
984720292 4:182965726-182965748 TCCAGAATAGACCATATGCTAGG + Intergenic
985008382 4:185557642-185557664 ACCAAGATAGACCATATGATAGG - Intergenic
985108042 4:186518194-186518216 TCCAAGATAGACCATATGATAGG - Intronic
985416974 4:189745234-189745256 TCCAAAATAGACTATATGATAGG + Intergenic
986129708 5:4917383-4917405 ACCAAGATAGACCAAATTCTGGG + Intergenic
986259228 5:6128548-6128570 TCCAAGATAGACCATATGATAGG + Intergenic
986304235 5:6503636-6503658 ACCAAGCTAGGCCATGTGCCTGG + Intergenic
986406434 5:7429492-7429514 ACTAAGATAGACCATATTCTGGG + Intronic
986456134 5:7921460-7921482 ACCAAGATAGACCATATTACAGG - Intergenic
986617647 5:9636352-9636374 TCCAATATAGACCATATGATGGG - Intronic
986634265 5:9804470-9804492 TCCAAGATAGACCATATGATAGG + Intergenic
986870452 5:12039055-12039077 TCCAAGATAGACCATATGATAGG + Intergenic
987030190 5:13969721-13969743 TCCAAGATAGACCATGTGACAGG - Intergenic
987248392 5:16073975-16073997 TCCAAGATAGACCATATGATAGG + Intronic
987403770 5:17504069-17504091 ACCACAATAGTACATATGTCAGG - Intergenic
987530326 5:19110351-19110373 TCCAGGAAAGACCATATGCCAGG - Intergenic
987577954 5:19754738-19754760 TCCAAGATAGACCATATGATAGG + Intronic
987703789 5:21436616-21436638 ACCAAAATAAAATAAATGCCTGG + Intergenic
987731164 5:21774469-21774491 CCCACAATAGACCATCTGCAAGG - Intronic
987846499 5:23294036-23294058 TCCAAGATAGACCATATGATAGG - Intergenic
987902103 5:24025670-24025692 TTCAAAATAGACCATATGATAGG + Intronic
987916679 5:24224192-24224214 TCCAAGATAGACCATATGATAGG - Intergenic
988352749 5:30132969-30132991 TCCAGAATAGACCATATGTTGGG - Intergenic
988613233 5:32748307-32748329 AGGAAAATAGAGCCTATGCCAGG + Intronic
988724355 5:33911160-33911182 ATCAAAACAGACCACATGCTGGG - Intergenic
988823076 5:34907081-34907103 CCCAGAATTGTCCATATGCCTGG + Exonic
988902463 5:35747911-35747933 TCCAAGATAGACCATATGATAGG + Intronic
988929532 5:36023242-36023264 TCCAAGATAGACCATATGAAAGG - Intergenic
988999436 5:36745127-36745149 ACCAAAACAGACCAAATGGGAGG - Intergenic
989355217 5:40536761-40536783 TCCAAGATAGACTATATGACAGG - Intergenic
989515156 5:42334514-42334536 ACCAAGATAGACCACATTCTGGG + Intergenic
989694154 5:44180063-44180085 TCTAAAATAGACCATATGATAGG - Intergenic
989776547 5:45215134-45215156 ACCAAGATAGACCACATTCCAGG + Intergenic
990233569 5:53741575-53741597 TCCAAGATAGACCATATGATAGG + Intergenic
990244092 5:53846094-53846116 ACCAAGATAGACCACATTCTGGG + Intergenic
990292134 5:54363046-54363068 AACAAAACAGACCAAATTCCTGG + Intergenic
990292861 5:54371940-54371962 TCCAAAATAGACTATATGTTAGG - Intergenic
990421838 5:55643445-55643467 TCCAAGATAGACCATATGCTGGG - Intronic
990712600 5:58602263-58602285 TCCAAGATAGACCATATGATAGG - Intronic
990756531 5:59077985-59078007 ACCAAATTTGACCAGATGCGCGG - Intronic
990775902 5:59305814-59305836 TCCAAGATAGACCATATGATAGG - Intronic
990885818 5:60592088-60592110 ACAAAAATTGACCATATACTAGG + Intergenic
990891532 5:60656030-60656052 TCCAAGATAGACCATATGATAGG - Intronic
991108148 5:62865862-62865884 TCCAAAATTGACCACATGCTGGG + Intergenic
991213301 5:64132512-64132534 TCCAAAATTGACCACATGCTGGG - Intergenic
991238614 5:64429255-64429277 TCCAAAATAGACCATATCTTAGG + Intergenic
991529684 5:67601743-67601765 TCCAAAATTGACCACATGCTTGG - Intergenic
991546749 5:67790739-67790761 ACCAACATATACCTTATGCTAGG + Intergenic
991924103 5:71686652-71686674 TCCAAAATAGACCATATGATAGG + Intergenic
992276165 5:75121534-75121556 TCCCAAATAGACCATATGTTAGG + Intronic
992335820 5:75768240-75768262 TCCAAGATAGACCATATGATAGG - Intergenic
992339860 5:75812237-75812259 TCCAAGATAGACCATATGATAGG - Intergenic
992342118 5:75835158-75835180 ACCAAAATAGACAATTTTCTGGG - Intergenic
992616462 5:78550445-78550467 TCCAAAATAGTCCCTATGCATGG + Intronic
992755868 5:79905013-79905035 TCCAAAATTGACCACATGCTTGG + Intergenic
992908152 5:81368421-81368443 ACCAAAATAGTCCATATTTTGGG + Intronic
993250110 5:85511030-85511052 TCCAAGATAGACCATATGATAGG - Intergenic
993257343 5:85608292-85608314 TCAAAAATAGACCATATGTTAGG + Intergenic
993388962 5:87294760-87294782 ACCAACATAGACCACATTCTGGG - Intronic
993646369 5:90468654-90468676 TCCAAGATAGACCATATGATAGG + Intronic
993786021 5:92137767-92137789 ACAAAAATAGCCCATATGTTGGG - Intergenic
993948340 5:94141955-94141977 TCTAAAATAGACCATATGATAGG - Intergenic
994051090 5:95363424-95363446 TCCAACATAGACCATATGATAGG - Intergenic
994542078 5:101111870-101111892 TCCAAAATTGACCATATCCTGGG - Intergenic
994559559 5:101349987-101350009 TCCAAAACAGACCACATGCATGG + Intergenic
994803676 5:104414947-104414969 ACCAAAATAGACCATATCCTTGG + Intergenic
994823116 5:104679105-104679127 TCCAAAACAGACCATATGATAGG + Intergenic
994859955 5:105178700-105178722 TCCAAGATAGACTAAATGCCTGG + Intergenic
995104376 5:108357559-108357581 ACCAAAACAAACCACATTCCAGG + Intronic
995169202 5:109087289-109087311 ACCAAAAAGGACCATGTGCATGG - Intronic
995192355 5:109331012-109331034 AACAAAATAGACAAGATCCCTGG - Intergenic
995202768 5:109445033-109445055 TCCAAAATTGACCACATGCTTGG - Intergenic
995450901 5:112299444-112299466 TCCAAAATAGACCATATGATAGG - Intronic
995622105 5:114037987-114038009 ACCAAAATAAACCATATGCTTGG - Intergenic
995673730 5:114638139-114638161 ACTAAAATAGACCATATGTGGGG + Intergenic
996050879 5:118931813-118931835 ACCAAAACAGACCACATTCTGGG + Intronic
996123813 5:119702782-119702804 TCCAAGATAGACCATATGATAGG - Intergenic
996141102 5:119910684-119910706 TCCAAGATAGACCATATAACAGG - Intergenic
996217801 5:120890858-120890880 TCCAAAATTGACCATATGCTTGG - Intergenic
996326781 5:122284199-122284221 TCCAAGATAGACCATATGATAGG - Intergenic
996458182 5:123709102-123709124 CCCCAAATAGACCATATGCTGGG + Intergenic
996460800 5:123740095-123740117 ACTAAAATAGGCCATATTCTGGG - Intergenic
996623487 5:125539667-125539689 ACCAAAATTGACCATATTCTGGG - Intergenic
996684053 5:126260368-126260390 TCTAAAATAGACCATATGTTAGG + Intergenic
997003858 5:129795664-129795686 TCCAAGATAGACCATATGATAGG - Intergenic
997048407 5:130348633-130348655 TCTAGAATAGACCATATGCTAGG - Intergenic
997074427 5:130655058-130655080 ACCACAATAGCCCTTATGCTTGG - Intergenic
997403826 5:133626798-133626820 AACAAAATAGACCATATACTGGG - Intergenic
997492737 5:134292197-134292219 ACTAAGATAGACCATATGCTAGG + Intronic
998180467 5:139935440-139935462 ACCAAATTAGACCACATTCTGGG + Intronic
998499581 5:142620819-142620841 ACGAAAATTGACCATGTACCAGG + Intronic
998746292 5:145263411-145263433 TCCAAGATAGACCATACGCTAGG + Intergenic
998941108 5:147283021-147283043 TCCAAGATAGACCATATGATAGG + Intronic
999066305 5:148689701-148689723 TCCAAAATAGACCATTTGCTTGG + Intergenic
999070732 5:148740863-148740885 ATCAAAATCCACCAAATGCCTGG + Intergenic
999106955 5:149081013-149081035 TCCAGGATAGACCATATGCTAGG + Intergenic
999490918 5:152050785-152050807 TCCAAGATAGACCATATGATAGG - Intergenic
999563539 5:152831999-152832021 ACCAAGATAGACCATATACTGGG - Intergenic
999837025 5:155385194-155385216 ACCAACATAGACCACATCCTGGG + Intergenic
999839146 5:155405582-155405604 TCCAAGATAGACCATATGATAGG + Intergenic
1000394871 5:160763288-160763310 TCCAAGATAGACCATATGATAGG + Intronic
1000434196 5:161187734-161187756 ACCAAGATAACCCATATGCCTGG - Intergenic
1000757683 5:165181887-165181909 TCCAAGATAGACCATATGATAGG - Intergenic
1000786994 5:165557127-165557149 ATCAAAATAGAGCCTATGCTTGG - Intergenic
1000870231 5:166567846-166567868 ACCAAGATGGACCACATGCCAGG + Intergenic
1001166903 5:169377155-169377177 TCCAAGATAGACCATATGATAGG + Intergenic
1001176943 5:169478730-169478752 TCCAAGATAGACCATATGATAGG - Intergenic
1001262446 5:170243194-170243216 TCCAAAATTGACCATATACTTGG - Intronic
1001290930 5:170459418-170459440 TCCAAGATAGACCATATGATAGG + Intronic
1001418542 5:171567720-171567742 ACCAAGATAGACCATATTTTGGG - Intergenic
1001693544 5:173651726-173651748 TCCAAGACAGACCATATGACAGG - Intergenic
1001900490 5:175423164-175423186 ACCAAGATAGACCACATTCTGGG + Intergenic
1002088275 5:176789554-176789576 ACCAAAATAAATCAAATGCGTGG + Intergenic
1002318503 5:178361212-178361234 AACAGAATAGACCTTATGGCAGG - Intronic
1002812367 6:643303-643325 ACCAAGATAGACGATATGCTGGG + Intronic
1002814096 6:662380-662402 TCCAAGATAGACTATATGACAGG + Intronic
1002849170 6:977277-977299 TCCAAGATAGACCATATGATAGG - Intergenic
1002920661 6:1569009-1569031 GCCATAAGAGACCATATGCCAGG - Intergenic
1003293150 6:4799314-4799336 ACCAAGACAGACCATATACTGGG - Intronic
1003465178 6:6372823-6372845 TCCAAAATAGACCATATGATAGG + Intergenic
1003582250 6:7350486-7350508 TCCAAAATAGACCATATCATAGG + Intronic
1003711743 6:8600473-8600495 TCCAAGATAGACCATATGATAGG - Intergenic
1004479266 6:16003308-16003330 ACAAAGACAGACCATGTGCCAGG + Intergenic
1004592173 6:17062795-17062817 ACCAAGATGGACCATATTCTGGG + Intergenic
1005102169 6:22183516-22183538 TCCAGGATAGACCATATGCTAGG - Intergenic
1005305512 6:24510218-24510240 TCCAAGATAGACCATATGATAGG - Intronic
1005362680 6:25046087-25046109 TTCAAAATCGACCATATGCTTGG + Intergenic
1005760572 6:28963817-28963839 TCCAAGATAGACCATATGATAGG + Intergenic
1006426878 6:33969758-33969780 ACCAATATAGACCATTTCCTCGG + Intergenic
1006590753 6:35154463-35154485 AACAAAATAGGCCATATTCTGGG - Intergenic
1006895576 6:37467416-37467438 ACCAAGATAGAGCATATGATGGG - Intronic
1007030709 6:38623475-38623497 TCCCAAATAGACCATTTGACAGG + Intronic
1007732948 6:43961441-43961463 ACCAGAACAGACCATATACTAGG + Intergenic
1007892950 6:45312864-45312886 GCCAAGATAGACCATATGATAGG + Intronic
1008115750 6:47547751-47547773 TCCAAGATAGACCATATGATAGG + Intronic
1008305547 6:49894630-49894652 TCCAAGATAGACCATATGATAGG + Intergenic
1008341696 6:50373191-50373213 TCCAAAATAGACAATATAACAGG - Intergenic
1008431497 6:51422911-51422933 TCCAAGATAGACCATATGATAGG + Intergenic
1008453463 6:51680518-51680540 ACCAAAATAGAACATATACCTGG - Intronic
1008772424 6:54994831-54994853 TCTAAAATAAACCATATGCTTGG + Intergenic
1008967861 6:57332281-57332303 TCCAGAACAGACCATATGCTAGG - Intronic
1008973346 6:57396069-57396091 TCCAAGATAGACTATATGACAGG - Intronic
1009162252 6:60297609-60297631 TCCAAGATAGACTATATGACAGG - Intergenic
1009419811 6:63453204-63453226 ACCAAGATAGACCATATTCCAGG - Intergenic
1009499901 6:64398412-64398434 ATTAAAATTGACCATATGCTGGG - Intronic
1009644545 6:66381094-66381116 TCCAAGATAGACCATATGATAGG - Intergenic
1010077185 6:71812723-71812745 TCCAAAATAGAACATATGTTAGG + Intergenic
1010181664 6:73093821-73093843 TCCAAGGTAGACCATATGACAGG - Intronic
1010320854 6:74507917-74507939 TCCAAGATAGACCATATGTTAGG + Intergenic
1010458963 6:76091573-76091595 TCCAAGATAGACCATATGACAGG - Intergenic
1010473348 6:76256840-76256862 CCCAAGATTGACCATATGCTTGG - Intergenic
1010500729 6:76596226-76596248 TCCAAGATAGACCATATGATGGG + Intergenic
1010633467 6:78228756-78228778 TCCAAGATAGACCATATGGTAGG - Intergenic
1010706620 6:79120722-79120744 CCCAAGATAGACCATATGTTAGG + Intergenic
1010957666 6:82108539-82108561 TCCAAAATAGACCATATGTTAGG + Intergenic
1011080251 6:83482564-83482586 ACCAAAATAGACAATATTCTGGG + Intergenic
1011225402 6:85099618-85099640 TCCAAGATAGACCATATGATAGG + Intergenic
1011252478 6:85387049-85387071 ACCAAGCTATACCATATGCTAGG + Intergenic
1011321724 6:86102324-86102346 TCAAAAAGAGACCATATGCTAGG - Intergenic
1011328848 6:86181582-86181604 TCCAAAATAGACCATATGATAGG - Intergenic
1011365826 6:86581491-86581513 TCCAAGATAGACCATATGACAGG - Intergenic
1011833943 6:91406771-91406793 TCCAAGATAGACCATATGATAGG + Intergenic
1012013600 6:93825768-93825790 ATCAAGATAGACCATATACTAGG - Intergenic
1012146288 6:95687124-95687146 ACCCAAATTGGGCATATGCCAGG - Intergenic
1012208148 6:96487153-96487175 TCCAAGATAGACCATATGATAGG - Intergenic
1012273347 6:97242014-97242036 TCCAAGATAGACCATATGATAGG - Intronic
1012302766 6:97610215-97610237 ACCAAGATAGACAATATGATAGG - Intergenic
1012314610 6:97770257-97770279 AAAAAAATAGACCATGGGCCGGG - Intergenic
1012328451 6:97954269-97954291 ACCAAGACAGACCATATTCCGGG - Intergenic
1012717539 6:102695898-102695920 ACAACAATAGACCATATGTTAGG - Intergenic
1012786435 6:103634178-103634200 TCCAAGATAGACCATATGATAGG + Intergenic
1012845894 6:104388194-104388216 TCCAGAATAAACCATATGCTGGG + Intergenic
1012922963 6:105238303-105238325 ACCAAGATAGACCAGATGATAGG + Intergenic
1013136320 6:107286210-107286232 ACTAAAATATACCATAGGCTGGG + Intronic
1013190333 6:107798982-107799004 ACCAACATAGACAATAAGCTGGG - Intronic
1013686222 6:112587001-112587023 TCCAAGATAGACCATATGATAGG - Intergenic
1013946216 6:115725983-115726005 TCCAAAATAGACCATATGATAGG - Intergenic
1013982550 6:116149629-116149651 TCCAAAAAAGCCCAAATGCCTGG + Intronic
1014095880 6:117460825-117460847 ACCAACATAGACCATATCCTGGG + Intronic
1014297110 6:119632544-119632566 ACTAAAATAGACCATCTTCTAGG + Intergenic
1014420085 6:121233123-121233145 TCCAAGATAGACCATATGAGAGG - Intronic
1014566778 6:122958658-122958680 TGCAAAATAGACCATATGATAGG + Intergenic
1014662595 6:124192504-124192526 ACCAAAATAGACCATATGCCTGG - Intronic
1014716964 6:124877769-124877791 ACCAAGATAGACTATATCCTGGG - Intergenic
1014765266 6:125398808-125398830 TCCAAAATAGACCACATAGCTGG + Intergenic
1015027051 6:128547463-128547485 ACCAAAATATGCCATATCCTGGG + Intergenic
1015092885 6:129379855-129379877 ACTCAAACTGACCATATGCCTGG - Intronic
1015877739 6:137840780-137840802 TCCAAGACAGACCATATGACAGG - Intergenic
1015924318 6:138294137-138294159 CCCTGAATAAACCATATGCCAGG + Intronic
1016018142 6:139207208-139207230 TCCAAGATAGACCATATGATAGG + Intergenic
1016129863 6:140454231-140454253 ACCACGATAAACCATATGCTGGG - Intergenic
1016176112 6:141079442-141079464 TCCAAGATAGACCATATGATAGG + Intergenic
1016247469 6:142000700-142000722 TCCAAAATAGACCATATGTTAGG + Intergenic
1016262965 6:142195940-142195962 ACCAAGACAGATCATATGCTGGG - Intronic
1016289736 6:142516025-142516047 TCCAAGATAGACCATATGATAGG - Intergenic
1016909907 6:149188228-149188250 TCCAAGATAGACCATATAACAGG - Intergenic
1017217670 6:151928969-151928991 ACCAAGATAGACCACATTCTGGG - Intronic
1017384217 6:153864086-153864108 TCCAGAATAGACCATATGTTAGG + Intergenic
1017612775 6:156208568-156208590 ACCAAAATTGATCATATGCTGGG - Intergenic
1018271438 6:162082611-162082633 GCCAATATAGACCAAATGCTAGG - Intronic
1018353049 6:162982718-162982740 TCCAAGATAGACCATATGATAGG - Intronic
1018410512 6:163541361-163541383 ATCAAAACAGACCATATGCTGGG - Intronic
1018539807 6:164866694-164866716 TCCATAATAGACCATATGTTAGG + Intergenic
1018755495 6:166845438-166845460 TCCAAGATAGACCATATGATAGG + Intronic
1019380608 7:720400-720422 ACCAAGATATACCATATCCTGGG - Intronic
1019904995 7:4056041-4056063 ACCAAGATTGACCATATCCTAGG - Intronic
1019933554 7:4239661-4239683 ATCAAAACAGGCCATAGGCCGGG - Intronic
1019935476 7:4253546-4253568 TCCAGTATAGACCATAGGCCAGG - Intronic
1020404846 7:7820676-7820698 ACCAAAATACACTAAATTCCAGG - Intronic
1020587950 7:10095207-10095229 ACCAAGATGGACCATATTCTGGG - Intergenic
1020866653 7:13572578-13572600 TCCAAGATAGACCATATGATAGG - Intergenic
1020969466 7:14916868-14916890 ACCAAGATAGACCACATTCTGGG + Intronic
1020997656 7:15283805-15283827 TCCAAGATAGACCATATGATAGG + Intronic
1021087638 7:16441793-16441815 ACCAATATAGACCAGATGGGGGG + Intergenic
1021112925 7:16716061-16716083 ACCAAGATAGACCATATGCTGGG - Intergenic
1021473864 7:21038107-21038129 TCCAAGATAGACCATATGATAGG - Intergenic
1021643041 7:22759169-22759191 ACCAATATCGACCATATCCTGGG - Intergenic
1021923930 7:25516644-25516666 ACCAAAATAGACTATATTCTGGG - Intergenic
1022061420 7:26799787-26799809 TCAAGAATAGACCATATGTCAGG + Intronic
1022420575 7:30218024-30218046 ACCAACATAGACCACATTCCGGG + Intergenic
1022659561 7:32354170-32354192 AATAAAATACACCAGATGCCAGG + Intergenic
1022754080 7:33266491-33266513 ACCAAGATAGATCATATTCTAGG - Intronic
1022905816 7:34854866-34854888 ACCAAAGTTGACCACATGCTAGG + Intronic
1023210746 7:37802365-37802387 ACCAAAATAGACCACATTCTTGG - Intronic
1023701499 7:42895829-42895851 TCCAAGATAGACCATATGATAGG + Intergenic
1023811008 7:43911788-43911810 TCCAAGATAGACCATATGTTAGG + Intronic
1024019705 7:45355768-45355790 ACCAAGATAGACCATATGGTAGG + Intergenic
1024166390 7:46736235-46736257 ACTAAAATAGCCCATATCCTGGG + Intronic
1024304704 7:47918594-47918616 TCCAAGATAGACCATATGATAGG + Intronic
1024307857 7:47943211-47943233 ACTTAAATAGTCCACATGCCAGG - Intronic
1024367084 7:48533411-48533433 TCCAAGATAGACCATATGATAGG - Intronic
1024390326 7:48803560-48803582 ACCAAGATAGACTACATGCTGGG + Intergenic
1024433273 7:49316103-49316125 ACCAAAATAGACCAAATCTTGGG + Intergenic
1024592587 7:50901431-50901453 TCCAAAATTGACCACATACCTGG + Intergenic
1024665343 7:51541461-51541483 TCCAAAATAGACCATATCCTAGG - Intergenic
1024745131 7:52397660-52397682 TCCAAGATAGACCATATGATAGG - Intergenic
1024769934 7:52710193-52710215 ACCAACATAGACTATATTCTGGG - Intergenic
1024917841 7:54524096-54524118 TCCAAGATAGACCATATGATAGG - Intergenic
1024946933 7:54817875-54817897 TCCAAGATAGACCATATGATAGG - Intergenic
1025641831 7:63380833-63380855 GCCAATATCTACCATATGCCGGG + Intergenic
1025773044 7:64531206-64531228 TCCAAGATAGACCATATGATAGG + Intronic
1026046861 7:66911800-66911822 ACCAAAAGAAGCCTTATGCCAGG - Intergenic
1026145370 7:67741898-67741920 ACCATATCAGACCATATGCCTGG - Intergenic
1026420201 7:70227843-70227865 ATCAAAATAGATCATATGCTAGG - Intronic
1027415814 7:77973340-77973362 ACCAAGATAGGCCATATTCATGG - Intergenic
1027417417 7:77987969-77987991 TCCAAGATAGACCATATGATAGG - Intergenic
1027423900 7:78042913-78042935 ATCAATATATACAATATGCCGGG + Intronic
1027699458 7:81451653-81451675 TCCAAGATAGACCATATGATAGG + Intergenic
1027951763 7:84825477-84825499 ACCAAGATAGACCATATCCTGGG + Intergenic
1028018971 7:85747331-85747353 TCCAAGATAGACCATATGACTGG + Intergenic
1028028469 7:85877109-85877131 TCCAAGATAGACAATATGCTAGG + Intergenic
1028182784 7:87746215-87746237 TCCAAGATAGACCATATGATAGG - Intronic
1028255662 7:88593999-88594021 TCCAAAATAGACCATAAGCTTGG + Intergenic
1028371653 7:90099377-90099399 ACCAAAAGAGGCCATATCACAGG + Intergenic
1028502104 7:91530235-91530257 TCCAAGATAGACCATATGATAGG + Intergenic
1028519234 7:91711086-91711108 ACCAAAATAGACCATATGTTAGG + Intronic
1028532665 7:91854861-91854883 TCTAAAATTGACCATATGCTTGG + Intronic
1028641783 7:93050399-93050421 ATCAAGATAGACCATATGCTGGG + Intergenic
1028783101 7:94759679-94759701 TCCAAGATAGACCATATGATAGG + Intergenic
1028833900 7:95353109-95353131 ACAAAAATTGACTATATACCTGG - Intergenic
1028936644 7:96472151-96472173 TCCAAGATAGACCATATGATAGG - Intergenic
1029053399 7:97713771-97713793 TCCAAGATAGACCATATGATAGG + Intergenic
1029787017 7:102802267-102802289 TCCAAGATAGACCATATGATAGG + Intronic
1030390218 7:108918752-108918774 TCCAAGATAGACCATATGATAGG - Intergenic
1030585403 7:111412387-111412409 ACTAAAATAGGGCATATTCCAGG + Intronic
1030711200 7:112751954-112751976 ACCAAGAAAGAGCATATGCTGGG - Intergenic
1030859124 7:114601860-114601882 ATCAAAATAAACCATATTCTTGG - Intronic
1031113034 7:117634864-117634886 ACCAAGATAGACCACATTCTGGG - Intronic
1031148027 7:118018857-118018879 TCCAAGATAGACCATATGATAGG + Intergenic
1031443199 7:121818864-121818886 ACCAAGATAGACCATATTCTAGG + Intergenic
1031465504 7:122105455-122105477 TCCAGAATAGACCATATGGTAGG + Intronic
1031500975 7:122515881-122515903 AACAAAATTGACCAAATGTCAGG - Intronic
1031611732 7:123835990-123836012 TCCAATATAGACCATATGATAGG - Intronic
1031675996 7:124612835-124612857 TTCAAAATAGACCATATACTGGG + Intergenic
1031879451 7:127179575-127179597 TCCAAGATAGACCATATGACAGG + Intronic
1032040326 7:128554597-128554619 ACCAAAATAGACCATATGCTGGG + Intergenic
1032112015 7:129084117-129084139 ACCTATATTTACCATATGCCAGG + Intergenic
1032288928 7:130568787-130568809 TCCAAAATAAACCATATGACAGG + Intronic
1032965821 7:137095972-137095994 TCTAAAATTGACCATATGCTTGG + Intergenic
1033027048 7:137784700-137784722 TCCAAGATAGACCATATGATAGG + Intronic
1033112924 7:138598546-138598568 ACCAAGATAAACCATATCCAGGG + Intronic
1033502721 7:141968283-141968305 ACAAAGATAGACAATATGCTGGG + Intronic
1033796075 7:144846643-144846665 ACTAAGATAGATTATATGCCAGG - Intergenic
1033816460 7:145080032-145080054 TCCAAGATAGACCATATGATAGG - Intergenic
1033885442 7:145938850-145938872 TCCAGGATAGACCATATGTCAGG + Intergenic
1033954849 7:146834118-146834140 ACCACCAGAGACTATATGCCTGG - Intronic
1034058631 7:148065205-148065227 TCCAAGATAGACCATATGATAGG - Intronic
1034159041 7:148979063-148979085 ACCAAGATAGACGATATTCCGGG + Intergenic
1034229162 7:149507506-149507528 ACCAAAATTCACCATATGTTAGG + Intergenic
1034232563 7:149543049-149543071 ACCAACATAGACCATATGTTGGG + Intergenic
1034247601 7:149660060-149660082 TCCAAGATAGACCATATGATAGG - Intergenic
1034321987 7:150193826-150193848 ACCAAGATAGACTATATTCTGGG - Intergenic
1034366921 7:150558681-150558703 ACTAAGATAGAACATATTCCAGG + Intergenic
1034395047 7:150816234-150816256 ACCAAGATAGACCATATCTTCGG + Intergenic
1034589016 7:152123244-152123266 ACCAAGATAGACCATATTCTGGG + Intergenic
1034705276 7:153137262-153137284 TCCAAGATAGACCATATGATAGG - Intergenic
1034755075 7:153609083-153609105 TTCAAAATAGACCCTATTCCAGG + Intergenic
1034857118 7:154561327-154561349 ACCAGAGTAGACTATATGCTGGG + Intronic
1035416949 7:158697257-158697279 ACACAAATATACCATAAGCCTGG - Intronic
1035553859 8:549403-549425 TCCAGAATAGACCGTATGTCAGG - Intergenic
1035797800 8:2375610-2375632 AGTAAAATACACGATATGCCAGG + Intergenic
1035985153 8:4421410-4421432 ACCAAGATAAACCATATTCGAGG + Intronic
1036052186 8:5211153-5211175 ACCAAAATAGACCATATATCTGG + Intergenic
1036081242 8:5558441-5558463 ACCAGTAGAGACCATATGCTGGG + Intergenic
1036383688 8:8259366-8259388 ACCAAGATAGATCATATTCTGGG - Intergenic
1037975195 8:23204630-23204652 TCCAAAATAAACCATATGCTTGG + Intronic
1038237302 8:25771767-25771789 TCCAAGATAGACCATATGATAGG + Intergenic
1038273791 8:26101245-26101267 ACAAAGATAGAACATATGCTGGG + Intergenic
1038908974 8:31940127-31940149 TCCAAGATAGACCATATGATAGG + Intronic
1038997630 8:32943175-32943197 TCCAGGATAGACCATATGCTGGG - Intergenic
1039021587 8:33213073-33213095 ACCAAAATAGATCATATGCTAGG + Intergenic
1039083065 8:33753074-33753096 TCCAAGATAGACCATATGATAGG - Intergenic
1039095329 8:33878585-33878607 TCCAAGATAGACCATATGAGAGG - Intergenic
1039200464 8:35086049-35086071 ACCAAAATAGACCATGTTCTAGG - Intergenic
1039700701 8:39958744-39958766 ACAAAAATAAACCAGGTGCCAGG - Intronic
1039748262 8:40452640-40452662 TCCAAAATAGACCATATGATAGG - Intergenic
1040025843 8:42781436-42781458 TCCAGAATACACCATATGCTAGG - Intronic
1040442604 8:47460050-47460072 TCCAAGATAGACCATATGATAGG - Intronic
1040511142 8:48096562-48096584 TCAAAAATAGACCATATGTTAGG - Intergenic
1040630350 8:49202717-49202739 AAAAAAATAGGCCATAGGCCAGG - Intergenic
1040824149 8:51601136-51601158 TCCAAGATTGACCATATGCTTGG - Intronic
1041113885 8:54515013-54515035 ACCAGTATAGACCATACGCTGGG + Intergenic
1041150537 8:54928152-54928174 TCCAAGATAGACCATATGATAGG + Intergenic
1041293431 8:56330622-56330644 TCCAAAATAGACCATATGATAGG - Intergenic
1041384481 8:57285152-57285174 ACCAAAATATACTATATGACAGG - Intergenic
1041507437 8:58615412-58615434 ACCAAGATAGGCCATATGCTGGG + Intronic
1041570311 8:59330810-59330832 TCCAAGATAGACCATATGATAGG - Intergenic
1041573162 8:59361155-59361177 ACAAAAATTGACCATATACTAGG + Intergenic
1041937169 8:63346677-63346699 ACCAACATGGATCATATGCTAGG - Intergenic
1042002479 8:64140966-64140988 TCCAGAATAGACCATATCTCTGG + Intergenic
1042122589 8:65504789-65504811 TCCAAGATAGACCATATGATAGG - Intergenic
1042202715 8:66296220-66296242 ACCAAGATAGACCATATGCTAGG - Intergenic
1042208631 8:66354560-66354582 ACAAAAATTGAACATGTGCCAGG + Intergenic
1042431621 8:68712898-68712920 CCCAAAATAGACCATATGATAGG + Intronic
1042644701 8:70973876-70973898 TCCAAGATAGACCATATGATAGG - Intergenic
1042848848 8:73195322-73195344 ATCAAAATAGACCACATTCTAGG + Intergenic
1042898224 8:73694411-73694433 ACCAAGACAGACCATATTCTGGG + Intronic
1043104181 8:76087442-76087464 TCTAAGATAGACCATATGACAGG - Intergenic
1043451357 8:80370722-80370744 ACCGAAATAGATCATGTGCTGGG + Intergenic
1043509203 8:80932882-80932904 CCCACAATAGACCATAGGCAAGG - Intergenic
1043537571 8:81223244-81223266 TCCAAGATAGACCATATGACAGG - Intergenic
1043545336 8:81308861-81308883 TCCAATATAGACCATATGATAGG + Intergenic
1043559487 8:81474290-81474312 TCCAAGATAGACCATATGTTAGG - Intergenic
1043616591 8:82132530-82132552 TCCAAGATAGACCATATGATAGG + Intergenic
1043803223 8:84638036-84638058 TCCAAGATAGACCATATGACAGG + Intronic
1043842178 8:85120143-85120165 ACCTAGAAAAACCATATGCCAGG - Intronic
1044228577 8:89748160-89748182 TCCAAGATAGACCATATGTTAGG + Intergenic
1044788269 8:95819405-95819427 ACTAAAATTGACCAGATGCTAGG - Intergenic
1044907466 8:97019953-97019975 TCCAAGATAGACCATATGATAGG + Intronic
1044916971 8:97124504-97124526 ACCATGATAGACTATATGCTGGG + Intronic
1044955816 8:97478686-97478708 ACCAAGATTGACCACATGCTTGG + Intergenic
1045095075 8:98788987-98789009 TCCAAGATAGACCATATGAGAGG + Intronic
1045209186 8:100077632-100077654 ACCAAAATAGACCACATTTTGGG - Intronic
1045620071 8:103967000-103967022 ACTAAAATAGAGCATATTCTGGG - Intronic
1045707251 8:104939668-104939690 ACCAAAATAGACCAAATTTAGGG - Intronic
1045878153 8:107006720-107006742 TCCAAGATAGACCATATGATAGG + Intergenic
1045881238 8:107043292-107043314 TCCAAGATAGACCATATGATAGG - Intergenic
1046235792 8:111422756-111422778 TCCAAGATAGACCATATGATAGG + Intergenic
1046284525 8:112077344-112077366 TCCAAGATAGACCATATGATAGG - Intergenic
1046579211 8:116070924-116070946 ACCAAAAGACACCATATTCTAGG - Intergenic
1046924185 8:119768574-119768596 CCCCAAATTGACCATATGCTTGG - Intronic
1046963640 8:120137998-120138020 AACAAAATAGGCCATATTCTGGG - Intronic
1047032597 8:120898669-120898691 TCCAAGATAGACCATATGATAGG + Intergenic
1047592304 8:126339852-126339874 TCCAAGATAGACCATATGATGGG + Intergenic
1047836027 8:128693183-128693205 AACAAAATAGACCATACCCTTGG - Intergenic
1047842620 8:128769654-128769676 TCCAAGATAGACCATATGAAAGG + Intergenic
1047908927 8:129504724-129504746 ACCAAAATAGATCACATCCTGGG + Intergenic
1047935345 8:129771397-129771419 TCCAAAATAGATCATATGTTAGG + Intronic
1048371460 8:133781496-133781518 TCCAAGATAGACCATATGACAGG - Intergenic
1048714088 8:137247608-137247630 TCCAAGATAGGCCATATGCTAGG + Intergenic
1048792745 8:138118753-138118775 TCCAAAATTGACCACATGCTTGG + Intergenic
1048897744 8:139008352-139008374 GCCAAAATAGACCAAATGTCGGG + Intergenic
1049045141 8:140144307-140144329 AGCAAAATATACCATATTCATGG - Intronic
1049231401 8:141486323-141486345 ACCAAGATAGACCATATGCTGGG - Intergenic
1049486065 8:142863162-142863184 TCCAAAATCGACCACATGCTTGG - Intronic
1050040380 9:1486818-1486840 ACAAAAATAGACCATATTCTGGG - Intergenic
1050147618 9:2585927-2585949 TCCAAGATAGACCATATGATAGG + Intergenic
1050236179 9:3583060-3583082 ACCAAAATAGACCATTTCCTGGG + Intergenic
1050493286 9:6212622-6212644 ACAAAAATAGCCTATATGTCTGG - Intergenic
1050493440 9:6214089-6214111 TCCAAAAAAGAGCATAAGCCAGG + Intergenic
1050606909 9:7311465-7311487 TCCAAAATAGACCATATGTTAGG - Intergenic
1050688819 9:8202390-8202412 TCCAAAATTGACCACATACCTGG - Intergenic
1050762750 9:9093410-9093432 ACCATGATAAACCATATTCCAGG + Intronic
1051324598 9:15951349-15951371 TCCAAAATTGACCACATACCTGG + Intronic
1051687439 9:19672949-19672971 TCCAAGATAGACCATATGATAGG - Intronic
1051715415 9:19977894-19977916 ACCAGAAAAGACCATGTTCCTGG + Intergenic
1051733424 9:20171940-20171962 TCCAAGATAGACCATATGATAGG + Intergenic
1051820270 9:21157728-21157750 ACTAATATAGATCATATGCTGGG + Intergenic
1052002240 9:23298758-23298780 ACCAAAATTAACCATCTGCTGGG + Intergenic
1052076779 9:24152123-24152145 ACCAAAATAAACCATGTTCTGGG - Intergenic
1052141303 9:24988570-24988592 TCCAAGATAGACCATATGATAGG - Intergenic
1052253782 9:26429425-26429447 AACAAGACAGACCATATGACAGG + Intergenic
1052288782 9:26818898-26818920 ACCAACATAGACCATATTTTAGG + Intergenic
1052314260 9:27099738-27099760 ACCAAGATAGACCACATTCTGGG + Intergenic
1052624683 9:30960120-30960142 TCCAAAATAGACCATATGATAGG - Intergenic
1053107098 9:35419416-35419438 TCCAAGATAGACCATATGATAGG + Intergenic
1053207932 9:36203587-36203609 CCCAAACTAGTCCATATTCCAGG - Intronic
1053753321 9:41277708-41277730 TCCAAGATAGACCATATGATAGG - Intergenic
1053884482 9:42632978-42633000 TCCAAGATAGACCATATGATAGG + Intergenic
1053888185 9:42661264-42661286 TCCAAGATAGACCATATGATAGG - Intergenic
1054227205 9:62468714-62468736 TCCAAGATAGACCATATGATAGG - Intergenic
1054258850 9:62842074-62842096 TCCAAGATAGACCATATGATAGG - Intergenic
1054332931 9:63777969-63777991 TCCAAGATAGACCATATGATAGG + Intergenic
1054762480 9:69015350-69015372 ACCAAGATAGATCATATTCTGGG - Intergenic
1054844591 9:69780307-69780329 TCCAAGATAGACCATATGATAGG - Intergenic
1054940714 9:70738099-70738121 TCCAAGATAGACCATATGATAGG + Intronic
1055125103 9:72710259-72710281 TCCAAGATAAACCATATGACAGG - Intronic
1055251359 9:74310511-74310533 TCCAAGATAGACCATATGCTAGG + Intergenic
1055330881 9:75182281-75182303 ACCAAAATTTACCATATACTAGG - Intergenic
1055519756 9:77068886-77068908 ACCAAAATAGACCACATTCTGGG - Intergenic
1055580165 9:77700040-77700062 ACCAAGATAGACCATATTCTGGG - Intergenic
1055846757 9:80574345-80574367 TCCAAGATAGACCATATGATAGG + Intergenic
1055905569 9:81290174-81290196 ACCAAAATAGATCATATGATAGG - Intergenic
1056014458 9:82368630-82368652 ACCAAAACAGACCAAATCACTGG - Intergenic
1056322501 9:85449800-85449822 TCCAAGATAGACCATGTGACAGG - Intergenic
1056582398 9:87901163-87901185 TCCAAGATAGACCATATGATAGG + Intergenic
1056620033 9:88204858-88204880 ACCAAAACAGTCCATATCCTTGG + Intergenic
1056765536 9:89442542-89442564 ATAAAAATAAACCATCTGCCTGG + Intronic
1056871062 9:90279419-90279441 ACCAAAATAGAACATATTCTGGG + Intergenic
1056882480 9:90410176-90410198 TCCAGAATAGACCATGTGCTAGG + Intergenic
1057119225 9:92556302-92556324 TCCAAGATAGACCATATGATAGG - Intronic
1057538267 9:95938267-95938289 ACCAAGATAGACCAAATCCTGGG - Intronic
1058024141 9:100122084-100122106 ACCAAAATATACAATATACTGGG - Intronic
1058084814 9:100737482-100737504 TCCAAGATAGACCATATGATAGG - Intergenic
1058232758 9:102449920-102449942 TCAAGGATAGACCATATGCCAGG + Intergenic
1058275964 9:103041556-103041578 TCCAAGATAGGCCATATGCTAGG + Intergenic
1058302675 9:103396028-103396050 TCCAAAATAGACCATATTCTTGG - Intergenic
1058410696 9:104727671-104727693 TCCAAGATAGACCATATGACGGG + Intergenic
1058540471 9:106007039-106007061 TCCAAGATAGACCATATGATAGG - Intergenic
1058622966 9:106903341-106903363 TCCAAGATAGACCATATGATAGG - Intronic
1058770893 9:108230590-108230612 TCCAAGATAGACCATATGATAGG + Intergenic
1059024711 9:110614004-110614026 ATCAAGAAAGACCATATGCTGGG + Intergenic
1059056724 9:110990323-110990345 ACCAATATAGACCATATTCTGGG + Intronic
1059369929 9:113821271-113821293 ACCAAAATAGACCGTATTATGGG + Intergenic
1059609354 9:115876028-115876050 TCCAAGATAGACCATATGATAGG - Intergenic
1059673999 9:116519233-116519255 TCCAAGATAGACCATATGATAGG + Intronic
1059966953 9:119624744-119624766 TCCAAAATTGACCATATACTTGG - Intergenic
1060502290 9:124169470-124169492 ATCAAGATAGACCATATTCTGGG - Intergenic
1061640985 9:131955043-131955065 ACCAAGACAGACCATAAGCCGGG + Intronic
1062023306 9:134329248-134329270 CCCAAAATAGAGCACATTCCGGG + Intronic
1062132167 9:134903338-134903360 ACCAACATAGACCATATTCTGGG + Intergenic
1062258385 9:135642874-135642896 ATCAAAATAAAGCATCTGCCAGG + Intergenic
1202799921 9_KI270719v1_random:166280-166302 TCCAAGATAGACCATATGATAGG + Intergenic
1186197482 X:7124124-7124146 TCCAGAATAGGCCATATGCTGGG + Intronic
1187109017 X:16276700-16276722 TCCAAGATAGACCATATGATAGG - Intergenic
1187114847 X:16338802-16338824 ACCAAGATAGACCACATTCTTGG - Intergenic
1187589078 X:20695880-20695902 TCCAAGATAGACCATATGATAGG + Intergenic
1187595636 X:20769556-20769578 ACCAAAATAGACCATATGCCAGG + Intergenic
1187994492 X:24910957-24910979 AACAAGATAGACCATATTCTGGG + Intronic
1188037100 X:25330760-25330782 TCCAAAATTGACCATATACTTGG + Intergenic
1188045658 X:25423763-25423785 TCCAAGATAGACCATATGATAGG - Intergenic
1188058422 X:25569187-25569209 TCCAAAATAGATCATATGATAGG - Intergenic
1188273651 X:28175015-28175037 TCCAAAATAGACCATACACTAGG - Intergenic
1188439359 X:30199639-30199661 ACCAATATAGACCATATTCTGGG + Intergenic
1188507846 X:30902298-30902320 AGCAAGATAGACCATATTCTGGG - Intronic
1188557469 X:31428766-31428788 AACAAAACAGACAATATCCCTGG + Intronic
1188871515 X:35379161-35379183 TCCAAAATTGAGCATATGCTTGG - Intergenic
1189151329 X:38710315-38710337 ACCAAGATAGACCATATTATGGG + Intergenic
1189575364 X:42346300-42346322 ACCAAAACAGACCATATCCTGGG - Intergenic
1189645428 X:43124061-43124083 ACCAAGATAAACCATTTTCCAGG - Intergenic
1189663035 X:43323951-43323973 TCCAAGATAGACCATATGATAGG - Intergenic
1189687259 X:43577468-43577490 ACCAAGATAGACCATATGTATGG + Intergenic
1189878919 X:45468889-45468911 TCCAAGATAGACCATATGGTAGG - Intergenic
1189893652 X:45631928-45631950 ACCAAAATTGACCATATTCTGGG - Intergenic
1189976943 X:46470911-46470933 ACCAAGATAGAACATATTCTGGG - Intronic
1190429303 X:50363966-50363988 TCCAAGATAGACCATATCCTAGG + Intergenic
1190449169 X:50560445-50560467 TCCAAGATAGACCATATGATAGG + Intergenic
1190502607 X:51094837-51094859 TCCAAGATAGACCATATGATAGG + Intergenic
1190540499 X:51473133-51473155 TGCAAAATAGATCATATGCTAGG - Intergenic
1190572425 X:51797482-51797504 AGCAAAATAAACCACAAGCCAGG - Intergenic
1190642179 X:52491110-52491132 ACCAAGATAGACCATATTGTGGG - Intergenic
1190645494 X:52521757-52521779 ACCAAGATAGACCATATTGTGGG + Intergenic
1190700522 X:52985126-52985148 ACCAAAATAGCCCATATCTTGGG + Intronic
1190747697 X:53335084-53335106 ACCAAGATAGACTATATTCTGGG + Intergenic
1190806520 X:53843237-53843259 ACCAAAATAAACGAAATTCCTGG + Intergenic
1190891200 X:54569969-54569991 ACCAATACAGACCATATTCTGGG - Intergenic
1190897104 X:54631148-54631170 TCCAAGATAGACCATATGATAGG - Intergenic
1190910120 X:54763565-54763587 ACCAAGATGGACCATATCCTTGG - Intronic
1190955659 X:55190558-55190580 TCCAAAATAGACCATATGGTAGG - Intronic
1191139520 X:57102014-57102036 TCCAAGATAGACCATATGATAGG + Intergenic
1191151593 X:57225554-57225576 TCCAAGATAGACCATATGATAGG - Intergenic
1191173369 X:57473440-57473462 TCCAAAATTGAACATATGCTTGG - Intronic
1191602885 X:63029582-63029604 TCCAAAATAGACCATGTGCTCGG - Intergenic
1191611888 X:63124920-63124942 TCCAAGATAGACCATATGTTAGG + Intergenic
1191656049 X:63600611-63600633 TCCAAAATTGACCACATACCGGG - Intergenic
1191677260 X:63804417-63804439 ACCAAAATATCCCCAATGCCTGG - Intergenic
1191855785 X:65625187-65625209 TCCAGAATAGACCATATGTTAGG - Intronic
1191903351 X:66062089-66062111 TCCAAGATAGACCATATGATAGG - Intergenic
1191924335 X:66293363-66293385 TCAAAAATAGACCATATGTTAGG - Intergenic
1191965026 X:66748575-66748597 TCCAAGATAGACCATATGATAGG - Intergenic
1192014400 X:67313693-67313715 TCCAAGATAGACCATATGATGGG - Intergenic
1192091394 X:68160508-68160530 TCCAGAATATACCATAAGCCAGG + Intronic
1192097121 X:68224177-68224199 ACCAAGATAGACCACATTCTGGG + Intronic
1192298273 X:69872975-69872997 TCCAAGATAGACCATATGATAGG + Intronic
1192376898 X:70571751-70571773 ACCAAAATAGATCATATGCTGGG - Intronic
1192691030 X:73364588-73364610 TCCAAAATAGACCATATTGTAGG - Intergenic
1192722920 X:73719111-73719133 TCCAAGATAGACCATATGTTGGG - Intergenic
1192820463 X:74639379-74639401 TCCAAGATAGACCATATGATAGG + Intergenic
1192842931 X:74876407-74876429 TCCAAAATTGACCATATACTTGG - Intronic
1192876840 X:75238691-75238713 TCCAAGATAGACCATATGATAGG + Intergenic
1192921435 X:75711061-75711083 TCCAAGATAGACCATATGGTAGG - Intergenic
1192969485 X:76216918-76216940 TCCAAGATAGACCATATGATAGG - Intergenic
1192991651 X:76465287-76465309 TCCAAGATAGACCATATGATAGG - Intergenic
1192994906 X:76503170-76503192 TCCAAGATAGACCATATGATAGG - Intergenic
1193185757 X:78510214-78510236 TCCAAGATAGACCATATGATAGG + Intergenic
1193208456 X:78777244-78777266 TCCAAGATAGACCATATGATAGG - Intergenic
1193251343 X:79294422-79294444 TCCAAGATAGACCATATGTTCGG + Intergenic
1193314844 X:80052783-80052805 TCCAAGATAGACCATATGATAGG - Intergenic
1193354596 X:80502961-80502983 TCCAAAATAGACCATATGATAGG + Intergenic
1193382844 X:80836354-80836376 TCCAAGATAGACCATATGATAGG + Intergenic
1193421044 X:81282404-81282426 TCCAACATAGACCATATGATAGG + Intronic
1193423549 X:81313880-81313902 TCCAAGATAGACCATATGATAGG - Intergenic
1193471128 X:81905751-81905773 CCCAAAATAGACCATATGATAGG - Intergenic
1193590128 X:83379143-83379165 TCCAAGATAGACCATATGATAGG - Intergenic
1193591878 X:83398496-83398518 TCCAAAATTGACCATATGCTTGG + Intergenic
1193617437 X:83707251-83707273 TCCAAGATAGACCACATGACAGG - Intergenic
1193771788 X:85596169-85596191 TCCAAGATAGACCATATGATAGG + Intergenic
1193817337 X:86119834-86119856 TCCAAGATAGACCATATGATAGG - Intergenic
1193939744 X:87667477-87667499 ACCAAAATATTCAATAAGCCTGG + Intronic
1193950740 X:87795168-87795190 TCCAAAATAGACCATATGATAGG - Intergenic
1194078262 X:89424882-89424904 TCCAAGATAGACAATATGCTTGG + Intergenic
1194432599 X:93828468-93828490 ACCAAGATACACCATATTCTGGG - Intergenic
1194504962 X:94723198-94723220 TCCAATATAGACCATATGATAGG - Intergenic
1194516154 X:94856812-94856834 TCCAAGATAGACCATATGATAGG + Intergenic
1194533776 X:95080527-95080549 TCCAAGATAGACCATATGATAGG + Intergenic
1194547455 X:95255414-95255436 TCCAAGATAGACCATATGATAGG - Intergenic
1194676088 X:96795348-96795370 ACCAGAATAGACTATATGCCAGG - Intronic
1194816019 X:98442361-98442383 TCCAAGATAGACCATATGATAGG + Intergenic
1194881621 X:99259153-99259175 TCCAAGATAGACCATATGATGGG - Intergenic
1194926446 X:99830825-99830847 TCCAAGATAGACCATATGATAGG - Intergenic
1194926688 X:99834261-99834283 TCCAAGATAGACCATATGACAGG - Intergenic
1194952800 X:100146233-100146255 ACCAAAATAGACCCTGTTCTAGG + Intergenic
1195033635 X:100950612-100950634 ACCAAAACAGATCATATCCTGGG + Intergenic
1195242911 X:102970824-102970846 TCCAAGATAGACCATATGATAGG + Intergenic
1195309646 X:103619018-103619040 TCCAGAATAGACCATATGCTAGG + Intronic
1195417734 X:104638773-104638795 TCCAGAATAGACCATATGTTAGG - Intronic
1195420996 X:104675515-104675537 ACCAAAATTGACCACATACTTGG - Intronic
1195443583 X:104924427-104924449 TCGAAAATTGACCATATGCTTGG + Intronic
1195783961 X:108496471-108496493 ACCAAGATAGAACATATTCTGGG - Intronic
1195795690 X:108644462-108644484 TCCAAGATAGACCATATGATAGG + Intronic
1195919835 X:109972727-109972749 ATCAAGATAGACCATATTCTGGG - Intergenic
1195972530 X:110489253-110489275 TCCAAGATAGACCATATGATAGG - Intergenic
1195999477 X:110765923-110765945 TGCAAAATAGACCATATGATAGG + Intronic
1196000109 X:110773795-110773817 GCCAAAATAGACCATATTCTGGG - Intronic
1196146974 X:112328733-112328755 ACCAAAATTGACCACATACTTGG + Intergenic
1196246060 X:113401958-113401980 CCCAATATAGACAATATGACTGG + Intergenic
1196599123 X:117581587-117581609 TCCAAGATAGACCATATGATAGG - Intergenic
1196675521 X:118416599-118416621 TCCAAGATAGACCATATGATAGG - Intronic
1196966418 X:121060968-121060990 TCCAAGATAGACCATATGAGAGG - Intergenic
1197055282 X:122111442-122111464 TCCAAGATAGACCATATGATAGG - Intergenic
1197090149 X:122526700-122526722 TCTAAAATAGACCATATGCTTGG + Intergenic
1197132679 X:123022719-123022741 TCCAAAATAGACCATAAGATAGG + Intergenic
1197184606 X:123572726-123572748 ACCAAGATAGACCATATGACAGG + Intergenic
1197363794 X:125538730-125538752 TCCAAGATAGACCATATGATAGG + Intergenic
1197398806 X:125963017-125963039 TCCAAGATAGACCATATGAAAGG + Intergenic
1197463628 X:126773912-126773934 TCCAAGATAGACCATATGATAGG + Intergenic
1197476089 X:126927372-126927394 TCCAAGATAGACCATATGATAGG - Intergenic
1197497246 X:127200028-127200050 ACCAAGAAAGACCATATGCTGGG + Intergenic
1197533092 X:127655040-127655062 AGAAAAAAAGACCATAGGCCAGG + Intergenic
1197574283 X:128190315-128190337 TCCAAGATAGACCATATGATAGG + Intergenic
1197575832 X:128210253-128210275 TCCAAGATAGACCATATGATAGG + Intergenic
1197589129 X:128386516-128386538 TCCAAGATAGACCATATGATAGG + Intergenic
1197711470 X:129673195-129673217 ACCAAGATAGACCATATTCTGGG - Intergenic
1197827402 X:130604837-130604859 CCCAAAATAGAGCAGATTCCAGG - Intergenic
1198211908 X:134524179-134524201 ACCAAGATAGAGCATATTCAGGG + Intergenic
1198408086 X:136336264-136336286 ACCAACATAGACCATACACTGGG - Intronic
1198559654 X:137835634-137835656 TCCAAGATAGACCATATGATAGG - Intergenic
1198664966 X:139010379-139010401 TCCAAAATGGACCATATGATAGG + Intronic
1198696453 X:139344200-139344222 AACAAAATAGATCTTATACCGGG - Intergenic
1198797051 X:140408322-140408344 TCCAAGATAGACCATATGATAGG - Intergenic
1198836618 X:140812392-140812414 TCCAAGATAGACCATATGATAGG - Intergenic
1198943040 X:141979643-141979665 TCCAAGATAGACCATATGATAGG - Intergenic
1198950350 X:142063103-142063125 TCCAAGATAGACCATATGATAGG - Intergenic
1198973705 X:142310872-142310894 ACCAAGATAGCCCATATGCTGGG + Intergenic
1199043811 X:143145816-143145838 TCCAAGACAGACCATATGACAGG + Intergenic
1199110255 X:143924109-143924131 ACCAATATTGACCATATTCTGGG + Intergenic
1199335780 X:146617989-146618011 TCCAAAATTGACCACATACCTGG + Intergenic
1199583797 X:149390211-149390233 ACCAAAATAGGCCATATTCTGGG + Intergenic
1199779096 X:151041877-151041899 ACCAAGATAGACCACATTCTGGG - Intergenic
1199821577 X:151454506-151454528 TCCAAGATAGACCATATGATAGG + Intergenic
1199865392 X:151843821-151843843 ACCAAAATAAACCATAATCTCGG + Intergenic
1199913886 X:152317544-152317566 TCCAAGATAGACCATATGATAGG + Intronic
1199926556 X:152472586-152472608 TCCAAGATAGACCATATGATAGG + Intergenic
1200090056 X:153631256-153631278 CCCAATATAGACGATATCCCAGG + Intergenic
1200112977 X:153752390-153752412 TCCAGGATAGACCATATGTCAGG + Intergenic
1200317871 X:155153237-155153259 TCCAAGATAGACCATATGATAGG - Intergenic
1200365707 X:155660435-155660457 TCCCAAATAGACCATATGCTAGG - Intronic
1200518094 Y:4173949-4173971 TCTAAAATAGATCATATGCTTGG - Intergenic
1200713164 Y:6507642-6507664 AACAAAATTGACCAAATGTCAGG - Intergenic
1200738307 Y:6825414-6825436 TCCAAGATAGACCATATGATAGG - Intergenic
1201020757 Y:9654399-9654421 AACAAAATTGACCAAATGTCAGG + Intergenic
1201316045 Y:12646669-12646691 TCCAAATTAGACCATATGATAGG + Intergenic
1201408776 Y:13676553-13676575 TCCAAGATAGACCATATGAGAGG + Intergenic
1201415391 Y:13744134-13744156 TCCAAAATTGACCACATACCTGG - Intergenic
1201978243 Y:19876896-19876918 TCAAGAATAGACCATATGTCAGG + Intergenic
1202594647 Y:26523999-26524021 TCCAAGATAGACCATATGTTAGG + Intergenic