ID: 1187600602

View in Genome Browser
Species Human (GRCh38)
Location X:20825139-20825161
Sequence CTGGGGGTAGGGAGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187600602_1187600612 14 Left 1187600602 X:20825139-20825161 CCTTCTCCACTCCCTACCCCCAG No data
Right 1187600612 X:20825176-20825198 CTAGGCAAAAATGCCTGCTTAGG No data
1187600602_1187600610 -4 Left 1187600602 X:20825139-20825161 CCTTCTCCACTCCCTACCCCCAG No data
Right 1187600610 X:20825158-20825180 CCAGATCTGATTTCCTTGCTAGG No data
1187600602_1187600613 15 Left 1187600602 X:20825139-20825161 CCTTCTCCACTCCCTACCCCCAG No data
Right 1187600613 X:20825177-20825199 TAGGCAAAAATGCCTGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187600602 Original CRISPR CTGGGGGTAGGGAGTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr